ID: 904391387

View in Genome Browser
Species Human (GRCh38)
Location 1:30188547-30188569
Sequence GAAGGACACCAACGGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904391387_904391396 14 Left 904391387 1:30188547-30188569 CCCTTCAGCCGTTGGTGTCCTTC No data
Right 904391396 1:30188584-30188606 GTGAATTTTGTTCATGCTCTAGG No data
904391387_904391397 28 Left 904391387 1:30188547-30188569 CCCTTCAGCCGTTGGTGTCCTTC No data
Right 904391397 1:30188598-30188620 TGCTCTAGGATTCAGCTCAGAGG No data
904391387_904391390 -8 Left 904391387 1:30188547-30188569 CCCTTCAGCCGTTGGTGTCCTTC No data
Right 904391390 1:30188562-30188584 TGTCCTTCCCCATCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904391387 Original CRISPR GAAGGACACCAACGGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr