ID: 904393237

View in Genome Browser
Species Human (GRCh38)
Location 1:30199417-30199439
Sequence GACTGAAGGTCCTTAGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904393233_904393237 -10 Left 904393233 1:30199404-30199426 CCCATCCAGTGTTGACTGAAGGT No data
Right 904393237 1:30199417-30199439 GACTGAAGGTCCTTAGGATCAGG No data
904393230_904393237 5 Left 904393230 1:30199389-30199411 CCAGAACAAAGGAGCCCCATCCA No data
Right 904393237 1:30199417-30199439 GACTGAAGGTCCTTAGGATCAGG No data
904393231_904393237 -9 Left 904393231 1:30199403-30199425 CCCCATCCAGTGTTGACTGAAGG No data
Right 904393237 1:30199417-30199439 GACTGAAGGTCCTTAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904393237 Original CRISPR GACTGAAGGTCCTTAGGATC AGG Intergenic
No off target data available for this crispr