ID: 904396782

View in Genome Browser
Species Human (GRCh38)
Location 1:30227638-30227660
Sequence CTGTAGACCTAGGAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904396782_904396790 10 Left 904396782 1:30227638-30227660 CCAAGCCCCTCCTAGGTCTACAG No data
Right 904396790 1:30227671-30227693 CTTCTCCCCCTCTGAGCCCCAGG No data
904396782_904396791 11 Left 904396782 1:30227638-30227660 CCAAGCCCCTCCTAGGTCTACAG No data
Right 904396791 1:30227672-30227694 TTCTCCCCCTCTGAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904396782 Original CRISPR CTGTAGACCTAGGAGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr