ID: 904397730

View in Genome Browser
Species Human (GRCh38)
Location 1:30233792-30233814
Sequence TCATCAAAGGAGGGAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904397730_904397740 27 Left 904397730 1:30233792-30233814 CCTCTCCCTCCCTCCTTTGATGA No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397730_904397739 12 Left 904397730 1:30233792-30233814 CCTCTCCCTCCCTCCTTTGATGA No data
Right 904397739 1:30233827-30233849 CATTAGCTGAGAGAATTTGTGGG No data
904397730_904397738 11 Left 904397730 1:30233792-30233814 CCTCTCCCTCCCTCCTTTGATGA No data
Right 904397738 1:30233826-30233848 GCATTAGCTGAGAGAATTTGTGG No data
904397730_904397741 28 Left 904397730 1:30233792-30233814 CCTCTCCCTCCCTCCTTTGATGA No data
Right 904397741 1:30233843-30233865 TTGTGGGAGTCCCCGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904397730 Original CRISPR TCATCAAAGGAGGGAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr