ID: 904397733

View in Genome Browser
Species Human (GRCh38)
Location 1:30233801-30233823
Sequence GATGTAGGATCATCAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904397733_904397744 24 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397744 1:30233848-30233870 GGAGTCCCCGATGCTGGGTGGGG No data
904397733_904397739 3 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397739 1:30233827-30233849 CATTAGCTGAGAGAATTTGTGGG No data
904397733_904397740 18 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397733_904397742 22 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397742 1:30233846-30233868 TGGGAGTCCCCGATGCTGGGTGG No data
904397733_904397738 2 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397738 1:30233826-30233848 GCATTAGCTGAGAGAATTTGTGG No data
904397733_904397741 19 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397741 1:30233843-30233865 TTGTGGGAGTCCCCGATGCTGGG No data
904397733_904397743 23 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397743 1:30233847-30233869 GGGAGTCCCCGATGCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904397733 Original CRISPR GATGTAGGATCATCAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr