ID: 904397735

View in Genome Browser
Species Human (GRCh38)
Location 1:30233805-30233827
Sequence GCAGGATGTAGGATCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904397735_904397741 15 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397741 1:30233843-30233865 TTGTGGGAGTCCCCGATGCTGGG No data
904397735_904397743 19 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397743 1:30233847-30233869 GGGAGTCCCCGATGCTGGGTGGG No data
904397735_904397744 20 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397744 1:30233848-30233870 GGAGTCCCCGATGCTGGGTGGGG No data
904397735_904397742 18 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397742 1:30233846-30233868 TGGGAGTCCCCGATGCTGGGTGG No data
904397735_904397740 14 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397735_904397739 -1 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397739 1:30233827-30233849 CATTAGCTGAGAGAATTTGTGGG No data
904397735_904397738 -2 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397738 1:30233826-30233848 GCATTAGCTGAGAGAATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904397735 Original CRISPR GCAGGATGTAGGATCATCAA AGG (reversed) Intergenic
No off target data available for this crispr