ID: 904397737

View in Genome Browser
Species Human (GRCh38)
Location 1:30233823-30233845
Sequence CAAATTCTCTCAGCTAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904397737_904397742 0 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397742 1:30233846-30233868 TGGGAGTCCCCGATGCTGGGTGG No data
904397737_904397741 -3 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397741 1:30233843-30233865 TTGTGGGAGTCCCCGATGCTGGG No data
904397737_904397748 13 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397748 1:30233859-30233881 TGCTGGGTGGGGCCCCTCTGAGG No data
904397737_904397740 -4 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397737_904397744 2 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397744 1:30233848-30233870 GGAGTCCCCGATGCTGGGTGGGG No data
904397737_904397743 1 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397743 1:30233847-30233869 GGGAGTCCCCGATGCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904397737 Original CRISPR CAAATTCTCTCAGCTAATGC AGG (reversed) Intergenic
No off target data available for this crispr