ID: 904397740

View in Genome Browser
Species Human (GRCh38)
Location 1:30233842-30233864
Sequence TTTGTGGGAGTCCCCGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904397730_904397740 27 Left 904397730 1:30233792-30233814 CCTCTCCCTCCCTCCTTTGATGA No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397735_904397740 14 Left 904397735 1:30233805-30233827 CCTTTGATGATCCTACATCCTGC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397737_904397740 -4 Left 904397737 1:30233823-30233845 CCTGCATTAGCTGAGAGAATTTG No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397732_904397740 21 Left 904397732 1:30233798-30233820 CCTCCCTCCTTTGATGATCCTAC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397734_904397740 17 Left 904397734 1:30233802-30233824 CCTCCTTTGATGATCCTACATCC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397736_904397740 3 Left 904397736 1:30233816-30233838 CCTACATCCTGCATTAGCTGAGA No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397733_904397740 18 Left 904397733 1:30233801-30233823 CCCTCCTTTGATGATCCTACATC No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data
904397731_904397740 22 Left 904397731 1:30233797-30233819 CCCTCCCTCCTTTGATGATCCTA No data
Right 904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904397740 Original CRISPR TTTGTGGGAGTCCCCGATGC TGG Intergenic
No off target data available for this crispr