ID: 904398456

View in Genome Browser
Species Human (GRCh38)
Location 1:30239598-30239620
Sequence TAAGCTTTCACCAGTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904398454_904398456 -10 Left 904398454 1:30239585-30239607 CCCTCAACTGAAATAAGCTTTCA No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398451_904398456 4 Left 904398451 1:30239571-30239593 CCCTTCTTCTCTTCCCCTCAACT No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398450_904398456 5 Left 904398450 1:30239570-30239592 CCCCTTCTTCTCTTCCCCTCAAC No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398447_904398456 27 Left 904398447 1:30239548-30239570 CCCCTTTCTCAGGAAGAAAGATC No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398453_904398456 -9 Left 904398453 1:30239584-30239606 CCCCTCAACTGAAATAAGCTTTC No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398449_904398456 25 Left 904398449 1:30239550-30239572 CCTTTCTCAGGAAGAAAGATCCC No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398448_904398456 26 Left 904398448 1:30239549-30239571 CCCTTTCTCAGGAAGAAAGATCC No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data
904398452_904398456 3 Left 904398452 1:30239572-30239594 CCTTCTTCTCTTCCCCTCAACTG No data
Right 904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904398456 Original CRISPR TAAGCTTTCACCAGTGCCTG AGG Intergenic
No off target data available for this crispr