ID: 904398854

View in Genome Browser
Species Human (GRCh38)
Location 1:30242359-30242381
Sequence TCATTTCTTTTTACAGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904398854_904398862 29 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398862 1:30242411-30242433 CTGCACTGGAGAAAGACAGGAGG No data
904398854_904398863 30 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398863 1:30242412-30242434 TGCACTGGAGAAAGACAGGAGGG No data
904398854_904398860 26 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398860 1:30242408-30242430 CTCCTGCACTGGAGAAAGACAGG No data
904398854_904398856 -1 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398856 1:30242381-30242403 ACCCATGAAGCTGAGCAAGGAGG No data
904398854_904398859 15 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398859 1:30242397-30242419 AAGGAGGAAGTCTCCTGCACTGG No data
904398854_904398855 -4 Left 904398854 1:30242359-30242381 CCTTGGGCTGTAAAAAGAAATGA No data
Right 904398855 1:30242378-30242400 ATGACCCATGAAGCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904398854 Original CRISPR TCATTTCTTTTTACAGCCCA AGG (reversed) Intergenic
No off target data available for this crispr