ID: 904400530

View in Genome Browser
Species Human (GRCh38)
Location 1:30253814-30253836
Sequence AAGCCTCCCTGCAGGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400530_904400538 15 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400538 1:30253852-30253874 GGTGGCAGTGGCTGCATCCCAGG No data
904400530_904400534 -3 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400534 1:30253834-30253856 CTTTCTTGGTTGTACCCTGGTGG No data
904400530_904400539 21 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400539 1:30253858-30253880 AGTGGCTGCATCCCAGGCTATGG No data
904400530_904400533 -6 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400533 1:30253831-30253853 AGGCTTTCTTGGTTGTACCCTGG No data
904400530_904400540 30 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400530_904400535 3 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400535 1:30253840-30253862 TGGTTGTACCCTGGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400530 Original CRISPR AAGCCTCCCTGCAGGTGCAC AGG (reversed) Intergenic