ID: 904400532

View in Genome Browser
Species Human (GRCh38)
Location 1:30253822-30253844
Sequence AACCAAGAAAGCCTCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400532_904400539 13 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400539 1:30253858-30253880 AGTGGCTGCATCCCAGGCTATGG No data
904400532_904400544 28 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400544 1:30253873-30253895 GGCTATGGAGACAAAGGTCAGGG No data
904400532_904400543 27 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data
904400532_904400538 7 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400538 1:30253852-30253874 GGTGGCAGTGGCTGCATCCCAGG No data
904400532_904400540 22 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400532_904400535 -5 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400535 1:30253840-30253862 TGGTTGTACCCTGGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400532 Original CRISPR AACCAAGAAAGCCTCCCTGC AGG (reversed) Intergenic