ID: 904400536

View in Genome Browser
Species Human (GRCh38)
Location 1:30253848-30253870
Sequence GGATGCAGCCACTGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400536_904400543 1 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data
904400536_904400544 2 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400544 1:30253873-30253895 GGCTATGGAGACAAAGGTCAGGG No data
904400536_904400546 22 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400536_904400540 -4 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400536_904400545 19 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400545 1:30253890-30253912 TCAGGGAGTCCCTGATGATGAGG No data
904400536_904400547 25 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400536 Original CRISPR GGATGCAGCCACTGCCACCA GGG (reversed) Intergenic