ID: 904400537

View in Genome Browser
Species Human (GRCh38)
Location 1:30253849-30253871
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400537_904400550 30 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data
904400537_904400546 21 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400537_904400543 0 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data
904400537_904400547 24 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data
904400537_904400540 -5 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400537_904400545 18 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400545 1:30253890-30253912 TCAGGGAGTCCCTGATGATGAGG No data
904400537_904400544 1 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400544 1:30253873-30253895 GGCTATGGAGACAAAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400537 Original CRISPR GGGATGCAGCCACTGCCACC AGG (reversed) Intergenic