ID: 904400540

View in Genome Browser
Species Human (GRCh38)
Location 1:30253867-30253889
Sequence ATCCCAGGCTATGGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400537_904400540 -5 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400536_904400540 -4 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400532_904400540 22 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data
904400530_904400540 30 Left 904400530 1:30253814-30253836 CCTGTGCACCTGCAGGGAGGCTT No data
Right 904400540 1:30253867-30253889 ATCCCAGGCTATGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400540 Original CRISPR ATCCCAGGCTATGGAGACAA AGG Intergenic