ID: 904400541

View in Genome Browser
Species Human (GRCh38)
Location 1:30253869-30253891
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400541_904400553 23 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data
904400541_904400551 13 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400551 1:30253905-30253927 TGATGAGGAGGAGGCAGTGGAGG No data
904400541_904400552 19 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400552 1:30253911-30253933 GGAGGAGGCAGTGGAGGCAGTGG No data
904400541_904400546 1 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400541_904400547 4 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data
904400541_904400550 10 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data
904400541_904400545 -2 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400545 1:30253890-30253912 TCAGGGAGTCCCTGATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400541 Original CRISPR GACCTTTGTCTCCATAGCCT GGG (reversed) Intergenic