ID: 904400542

View in Genome Browser
Species Human (GRCh38)
Location 1:30253870-30253892
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400542_904400545 -3 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400545 1:30253890-30253912 TCAGGGAGTCCCTGATGATGAGG No data
904400542_904400554 30 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400554 1:30253923-30253945 GGAGGCAGTGGATGGTGATGAGG No data
904400542_904400550 9 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data
904400542_904400546 0 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400542_904400553 22 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data
904400542_904400552 18 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400552 1:30253911-30253933 GGAGGAGGCAGTGGAGGCAGTGG No data
904400542_904400551 12 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400551 1:30253905-30253927 TGATGAGGAGGAGGCAGTGGAGG No data
904400542_904400547 3 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400542 Original CRISPR TGACCTTTGTCTCCATAGCC TGG (reversed) Intergenic