ID: 904400543

View in Genome Browser
Species Human (GRCh38)
Location 1:30253872-30253894
Sequence AGGCTATGGAGACAAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400532_904400543 27 Left 904400532 1:30253822-30253844 CCTGCAGGGAGGCTTTCTTGGTT No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data
904400536_904400543 1 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data
904400537_904400543 0 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400543 1:30253872-30253894 AGGCTATGGAGACAAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400543 Original CRISPR AGGCTATGGAGACAAAGGTC AGG Intergenic