ID: 904400544 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:30253873-30253895 |
Sequence | GGCTATGGAGACAAAGGTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904400537_904400544 | 1 | Left | 904400537 | 1:30253849-30253871 | CCTGGTGGCAGTGGCTGCATCCC | No data | ||
Right | 904400544 | 1:30253873-30253895 | GGCTATGGAGACAAAGGTCAGGG | No data | ||||
904400536_904400544 | 2 | Left | 904400536 | 1:30253848-30253870 | CCCTGGTGGCAGTGGCTGCATCC | No data | ||
Right | 904400544 | 1:30253873-30253895 | GGCTATGGAGACAAAGGTCAGGG | No data | ||||
904400532_904400544 | 28 | Left | 904400532 | 1:30253822-30253844 | CCTGCAGGGAGGCTTTCTTGGTT | No data | ||
Right | 904400544 | 1:30253873-30253895 | GGCTATGGAGACAAAGGTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904400544 | Original CRISPR | GGCTATGGAGACAAAGGTCA GGG | Intergenic | ||