ID: 904400546

View in Genome Browser
Species Human (GRCh38)
Location 1:30253893-30253915
Sequence GGGAGTCCCTGATGATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400542_904400546 0 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400541_904400546 1 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400536_904400546 22 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data
904400537_904400546 21 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400546 1:30253893-30253915 GGGAGTCCCTGATGATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400546 Original CRISPR GGGAGTCCCTGATGATGAGG AGG Intergenic