ID: 904400547

View in Genome Browser
Species Human (GRCh38)
Location 1:30253896-30253918
Sequence AGTCCCTGATGATGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400541_904400547 4 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data
904400542_904400547 3 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data
904400537_904400547 24 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data
904400536_904400547 25 Left 904400536 1:30253848-30253870 CCCTGGTGGCAGTGGCTGCATCC No data
Right 904400547 1:30253896-30253918 AGTCCCTGATGATGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400547 Original CRISPR AGTCCCTGATGATGAGGAGG AGG Intergenic