ID: 904400550 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:30253902-30253924 |
Sequence | TGATGATGAGGAGGAGGCAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904400542_904400550 | 9 | Left | 904400542 | 1:30253870-30253892 | CCAGGCTATGGAGACAAAGGTCA | No data | ||
Right | 904400550 | 1:30253902-30253924 | TGATGATGAGGAGGAGGCAGTGG | No data | ||||
904400537_904400550 | 30 | Left | 904400537 | 1:30253849-30253871 | CCTGGTGGCAGTGGCTGCATCCC | No data | ||
Right | 904400550 | 1:30253902-30253924 | TGATGATGAGGAGGAGGCAGTGG | No data | ||||
904400541_904400550 | 10 | Left | 904400541 | 1:30253869-30253891 | CCCAGGCTATGGAGACAAAGGTC | No data | ||
Right | 904400550 | 1:30253902-30253924 | TGATGATGAGGAGGAGGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904400550 | Original CRISPR | TGATGATGAGGAGGAGGCAG TGG | Intergenic | ||