ID: 904400550

View in Genome Browser
Species Human (GRCh38)
Location 1:30253902-30253924
Sequence TGATGATGAGGAGGAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400542_904400550 9 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data
904400537_904400550 30 Left 904400537 1:30253849-30253871 CCTGGTGGCAGTGGCTGCATCCC No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data
904400541_904400550 10 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400550 1:30253902-30253924 TGATGATGAGGAGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400550 Original CRISPR TGATGATGAGGAGGAGGCAG TGG Intergenic