ID: 904400551

View in Genome Browser
Species Human (GRCh38)
Location 1:30253905-30253927
Sequence TGATGAGGAGGAGGCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400542_904400551 12 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400551 1:30253905-30253927 TGATGAGGAGGAGGCAGTGGAGG No data
904400541_904400551 13 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400551 1:30253905-30253927 TGATGAGGAGGAGGCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400551 Original CRISPR TGATGAGGAGGAGGCAGTGG AGG Intergenic