ID: 904400551 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:30253905-30253927 |
Sequence | TGATGAGGAGGAGGCAGTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904400542_904400551 | 12 | Left | 904400542 | 1:30253870-30253892 | CCAGGCTATGGAGACAAAGGTCA | No data | ||
Right | 904400551 | 1:30253905-30253927 | TGATGAGGAGGAGGCAGTGGAGG | No data | ||||
904400541_904400551 | 13 | Left | 904400541 | 1:30253869-30253891 | CCCAGGCTATGGAGACAAAGGTC | No data | ||
Right | 904400551 | 1:30253905-30253927 | TGATGAGGAGGAGGCAGTGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904400551 | Original CRISPR | TGATGAGGAGGAGGCAGTGG AGG | Intergenic | ||