ID: 904400553

View in Genome Browser
Species Human (GRCh38)
Location 1:30253915-30253937
Sequence GAGGCAGTGGAGGCAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904400541_904400553 23 Left 904400541 1:30253869-30253891 CCCAGGCTATGGAGACAAAGGTC No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data
904400548_904400553 -7 Left 904400548 1:30253899-30253921 CCCTGATGATGAGGAGGAGGCAG No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data
904400542_904400553 22 Left 904400542 1:30253870-30253892 CCAGGCTATGGAGACAAAGGTCA No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data
904400549_904400553 -8 Left 904400549 1:30253900-30253922 CCTGATGATGAGGAGGAGGCAGT No data
Right 904400553 1:30253915-30253937 GAGGCAGTGGAGGCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904400553 Original CRISPR GAGGCAGTGGAGGCAGTGGA TGG Intergenic