ID: 904402280

View in Genome Browser
Species Human (GRCh38)
Location 1:30264580-30264602
Sequence GGTGCCAAGGGCCTACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904402273_904402280 1 Left 904402273 1:30264556-30264578 CCAGCAGATCTGCTGGCAGAGGA No data
Right 904402280 1:30264580-30264602 GGTGCCAAGGGCCTACAAGGGGG No data
904402270_904402280 24 Left 904402270 1:30264533-30264555 CCACGCTCTGGGGTGGCTGCTGT No data
Right 904402280 1:30264580-30264602 GGTGCCAAGGGCCTACAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904402280 Original CRISPR GGTGCCAAGGGCCTACAAGG GGG Intergenic
No off target data available for this crispr