ID: 904403125

View in Genome Browser
Species Human (GRCh38)
Location 1:30269863-30269885
Sequence GAATCCTCTGGAAGTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904403117_904403125 8 Left 904403117 1:30269832-30269854 CCTTCTGAGGGAGTGCTGACAAG No data
Right 904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG No data
904403116_904403125 12 Left 904403116 1:30269828-30269850 CCTTCCTTCTGAGGGAGTGCTGA No data
Right 904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG No data
904403113_904403125 24 Left 904403113 1:30269816-30269838 CCATTTCTCTTTCCTTCCTTCTG No data
Right 904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904403125 Original CRISPR GAATCCTCTGGAAGTCCTGG GGG Intergenic
No off target data available for this crispr