ID: 904407871

View in Genome Browser
Species Human (GRCh38)
Location 1:30305265-30305287
Sequence TGTGGTCACCAGATGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904407871_904407874 1 Left 904407871 1:30305265-30305287 CCCTGCATCATCTGGTGACCACA No data
Right 904407874 1:30305289-30305311 AAAGACAAAGACAGCAGAGATGG No data
904407871_904407875 11 Left 904407871 1:30305265-30305287 CCCTGCATCATCTGGTGACCACA No data
Right 904407875 1:30305299-30305321 ACAGCAGAGATGGCAGCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904407871 Original CRISPR TGTGGTCACCAGATGATGCA GGG (reversed) Intergenic
No off target data available for this crispr