ID: 904410533

View in Genome Browser
Species Human (GRCh38)
Location 1:30322232-30322254
Sequence GAGCCTCCCCACCAGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904410533_904410542 19 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410542 1:30322274-30322296 GGTGGGACAGAGGCTTCCACAGG No data
904410533_904410534 -7 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410534 1:30322248-30322270 GAGGCTCTGACTGTCACCCCAGG No data
904410533_904410537 2 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410537 1:30322257-30322279 ACTGTCACCCCAGGAAAGGTGGG No data
904410533_904410535 -2 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410535 1:30322253-30322275 TCTGACTGTCACCCCAGGAAAGG No data
904410533_904410536 1 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410536 1:30322256-30322278 GACTGTCACCCCAGGAAAGGTGG No data
904410533_904410539 9 Left 904410533 1:30322232-30322254 CCTGTGAGCTGGTGGGGAGGCTC No data
Right 904410539 1:30322264-30322286 CCCCAGGAAAGGTGGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904410533 Original CRISPR GAGCCTCCCCACCAGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr