ID: 904411774

View in Genome Browser
Species Human (GRCh38)
Location 1:30329036-30329058
Sequence GCTGGGCCCACCAGTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904411774_904411779 1 Left 904411774 1:30329036-30329058 CCCTCAGGACTGGTGGGCCCAGC No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data
904411774_904411780 6 Left 904411774 1:30329036-30329058 CCCTCAGGACTGGTGGGCCCAGC No data
Right 904411780 1:30329065-30329087 TTGAATGTTGCCTCACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904411774 Original CRISPR GCTGGGCCCACCAGTCCTGA GGG (reversed) Intergenic
No off target data available for this crispr