ID: 904411775

View in Genome Browser
Species Human (GRCh38)
Location 1:30329037-30329059
Sequence AGCTGGGCCCACCAGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904411775_904411779 0 Left 904411775 1:30329037-30329059 CCTCAGGACTGGTGGGCCCAGCT No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data
904411775_904411780 5 Left 904411775 1:30329037-30329059 CCTCAGGACTGGTGGGCCCAGCT No data
Right 904411780 1:30329065-30329087 TTGAATGTTGCCTCACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904411775 Original CRISPR AGCTGGGCCCACCAGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr