ID: 904411779

View in Genome Browser
Species Human (GRCh38)
Location 1:30329060-30329082
Sequence CCAAGTTGAATGTTGCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904411771_904411779 8 Left 904411771 1:30329029-30329051 CCTTCTGCCCTCAGGACTGGTGG No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data
904411768_904411779 18 Left 904411768 1:30329019-30329041 CCAATCTTGTCCTTCTGCCCTCA No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data
904411775_904411779 0 Left 904411775 1:30329037-30329059 CCTCAGGACTGGTGGGCCCAGCT No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data
904411774_904411779 1 Left 904411774 1:30329036-30329058 CCCTCAGGACTGGTGGGCCCAGC No data
Right 904411779 1:30329060-30329082 CCAAGTTGAATGTTGCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904411779 Original CRISPR CCAAGTTGAATGTTGCCTCA CGG Intergenic
No off target data available for this crispr