ID: 904413599

View in Genome Browser
Species Human (GRCh38)
Location 1:30341330-30341352
Sequence GCAGTCTTTAGGATGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904413599_904413602 -5 Left 904413599 1:30341330-30341352 CCTGAGCTCATCCTAAAGACTGC No data
Right 904413602 1:30341348-30341370 ACTGCCTACTGGTCATATGATGG No data
904413599_904413604 2 Left 904413599 1:30341330-30341352 CCTGAGCTCATCCTAAAGACTGC No data
Right 904413604 1:30341355-30341377 ACTGGTCATATGATGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904413599 Original CRISPR GCAGTCTTTAGGATGAGCTC AGG (reversed) Intergenic
No off target data available for this crispr