ID: 904414146

View in Genome Browser
Species Human (GRCh38)
Location 1:30345616-30345638
Sequence ATTTGTTTACATACTGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1710
Summary {0: 3, 1: 47, 2: 171, 3: 442, 4: 1047}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904414146_904414148 3 Left 904414146 1:30345616-30345638 CCACAGACAGTATGTAAACAAAT 0: 3
1: 47
2: 171
3: 442
4: 1047
Right 904414148 1:30345642-30345664 CTTTGGCTGTGTTCCAATAAAGG No data
904414146_904414150 21 Left 904414146 1:30345616-30345638 CCACAGACAGTATGTAAACAAAT 0: 3
1: 47
2: 171
3: 442
4: 1047
Right 904414150 1:30345660-30345682 AAAGGTTTATTTACAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904414146 Original CRISPR ATTTGTTTACATACTGTCTG TGG (reversed) Intergenic
900942163 1:5806599-5806621 ACTTCCTTACGTACTGTCTGTGG - Intergenic
901180732 1:7340141-7340163 ATTTGTTTACATATCGTCTATGG - Intronic
901307643 1:8244515-8244537 ATTTGTTTGCATATTGTCCAAGG + Intergenic
901350952 1:8596097-8596119 ATTTGTTTACAAATTGTCTATGG + Intronic
901584012 1:10271669-10271691 ATTTGTTTATGTATTGTCTATGG + Intronic
901777116 1:11567686-11567708 ATTTGTTTACACATTGTCTATGG + Intergenic
901803441 1:11722717-11722739 ATTCATTTACACACTCTCTGTGG - Exonic
902090226 1:13897155-13897177 ATTTATGTACATTTTGTCTGCGG + Intergenic
902093246 1:13921387-13921409 ATTTGCTTGCATATTGCCTGTGG - Intergenic
902190680 1:14760935-14760957 ATTTGTTTTCATATTGTCTATGG - Intronic
902386912 1:16081290-16081312 ATTTGTTTACCTATTGTCTCTGG + Intergenic
902445007 1:16457102-16457124 ATTTATTTACATATTGTCTGTGG - Intronic
902667252 1:17948328-17948350 ATTTGTTTACATATTGTCTGTGG + Intergenic
902709503 1:18228894-18228916 TTTCATTTACACACTGTCTGTGG - Intronic
902937594 1:19775573-19775595 ATTATTTCACCTACTGTCTGTGG + Intronic
903370784 1:22834569-22834591 ATTTGTTTACATGTTGCCTATGG - Intronic
903584186 1:24396556-24396578 GTTTGTTTATGTATTGTCTGTGG - Intronic
903695608 1:25204357-25204379 ACTTATTTGCATATTGTCTGTGG - Intergenic
904249299 1:29211406-29211428 AATTGTTTATATATTGCCTGTGG + Intronic
904386970 1:30149271-30149293 ATTTATTTTCACACTGTATGTGG + Intergenic
904414146 1:30345616-30345638 ATTTGTTTACATACTGTCTGTGG - Intergenic
904703184 1:32370851-32370873 ATTTGTTTACATACTGTCTATGG + Intronic
904723083 1:32525471-32525493 ATTCATTTATATATTGTCTGTGG - Intronic
904874084 1:33640491-33640513 ATTTGTTTACATATTGTCTGTGG + Intronic
904900441 1:33852857-33852879 ATTCATTTACAAATTGTCTGTGG + Intronic
905265330 1:36749698-36749720 ATTTGTTTACATATTATCTATGG - Intergenic
905385768 1:37602975-37602997 ATTTGTTTACATATGGTCTATGG + Intergenic
905657968 1:39698217-39698239 TTTTGTTTATATACAGTCTAGGG + Intronic
905664433 1:39754171-39754193 ATTTATTTACATATTGTCCATGG + Intronic
905708068 1:40077377-40077399 TACTTTTTACATACTGTCTGTGG - Intronic
906137439 1:43509299-43509321 ATTTGTTTACATATTGTCTATGG + Intergenic
906256083 1:44351503-44351525 CTTCCTTTTCATACTGTCTGTGG + Intronic
906474092 1:46155896-46155918 ATTCATTTACGTATTGTCTGTGG + Intronic
906548468 1:46640203-46640225 ATTTATTTACATATTATCTATGG - Intronic
906623233 1:47302640-47302662 GTTTCTTTACATACTGTGTATGG + Intronic
906931336 1:50172571-50172593 ATTTGTTTACATACTGTCTATGG + Intronic
906984189 1:50665604-50665626 ATTTGTTTACATATTTTCTCTGG + Intronic
907578306 1:55548751-55548773 ATTCATTTACATATTGTCTTTGG - Intergenic
907589166 1:55649456-55649478 ATTTGTTTAAGTATTGCCTGTGG + Intergenic
907622945 1:56000626-56000648 ATTTGTTTACATATTGTCTGTGG + Intergenic
907632722 1:56099718-56099740 ATTTGTTTGCATAGTGTCTATGG - Intergenic
907775343 1:57508612-57508634 ATTGGTTTAGACATTGTCTGTGG - Intronic
908338556 1:63152504-63152526 ATTAGTTTACGTATTGTCTGTGG - Intergenic
908406987 1:63824309-63824331 ATTTGTTTACAAATTATCTATGG - Intronic
908484709 1:64579125-64579147 ATTTGTTTACATATTGTTTACGG - Intronic
908640653 1:66219463-66219485 ATCTGTTTCCATTCTGCCTGTGG + Intronic
908703735 1:66928917-66928939 ATTGGTTTACAGACTGTCTGTGG + Intronic
908757626 1:67483371-67483393 ATTTGTTTATATATTGTGTATGG + Intergenic
909007905 1:70298796-70298818 ATTTATTTACATATTGTCTGTGG + Intronic
909108552 1:71444605-71444627 ATTTATTTACATATTTTCTGTGG + Intronic
909313789 1:74189135-74189157 CTTTCTTTCCATACTGTCTCAGG + Intronic
909360030 1:74749291-74749313 ATTTGATTACTTATTGTCTGAGG + Intronic
909614410 1:77590449-77590471 ATTTGTTTACATAATTTCTATGG + Intronic
909966386 1:81916121-81916143 ATGTATTTACTTACTGTCTAAGG + Intronic
909987696 1:82183081-82183103 ATTTATGTACATACGGTCTGTGG - Intergenic
910197845 1:84662970-84662992 ACTTGTTTATATACTGCCTATGG + Intronic
910341578 1:86194206-86194228 ATTGGTTCACATATTGTCTATGG + Intergenic
910749313 1:90611380-90611402 ATTTGTTTACAGATAGTCTATGG + Intergenic
910816309 1:91294559-91294581 ATTCATTTACATATTGTCTATGG + Intronic
910856390 1:91700066-91700088 GCTTATTTACATACTGTCTATGG + Intronic
911097851 1:94069828-94069850 ATGTGTTTCCTTACTCTCTGTGG - Intronic
911475796 1:98370686-98370708 ATTTGTTTAGAAATTGTCTATGG + Intergenic
911489960 1:98552329-98552351 ATTAATTTACATGCTGTCTATGG + Intergenic
911519877 1:98916573-98916595 ATTTGTTTATAAACTGTCCGTGG - Intronic
912205255 1:107501309-107501331 ATTTGTTGACTTGCTGTCTCTGG - Intergenic
912313426 1:108645673-108645695 ACTTGTTTTCACATTGTCTGTGG + Intergenic
912547847 1:110463975-110463997 ATTTGTTTACTTAATCTTTGGGG - Intergenic
912630694 1:111244176-111244198 TTTTTTTTACATATTGTCTGTGG + Intergenic
912653716 1:111465961-111465983 ATTCATTTACATATTGTCTGCGG + Intergenic
912922177 1:113879795-113879817 ACTTGTTTACATATTGTCCATGG - Intronic
913248891 1:116895120-116895142 ATTTGTGTATATCCTGTCTGGGG - Intergenic
913265295 1:117037222-117037244 ATTCGCTTACATACTGTCTGTGG + Intergenic
913346152 1:117813153-117813175 ATTCATTTACATAGTGTCTATGG - Intergenic
913362492 1:117997729-117997751 ATTTGTTTACATACTGTCTGTGG - Intronic
913399397 1:118412282-118412304 ATTTATTTTCATACTGTTGGAGG + Intergenic
913610691 1:120506985-120507007 ATATGTTTCCATACTTTCTCAGG - Intergenic
914332099 1:146681691-146681713 ATTTCTTAACATATTGTCTATGG + Intergenic
914421478 1:147532199-147532221 ATTTATTCACATATTGTCTATGG - Intergenic
914434921 1:147651395-147651417 ATTTGTTTGCATATTGTCTTTGG + Intronic
914580499 1:149015254-149015276 ATATGTTTCCATACTTTCTCAGG + Intronic
914725726 1:150325788-150325810 ATTTGTGGACAAACTGTTTGAGG + Exonic
914756454 1:150564372-150564394 ATTTGTTTACTTATTGTCTATGG - Intergenic
914942541 1:152035964-152035986 ATTCCCTTCCATACTGTCTGGGG - Intronic
914963273 1:152226196-152226218 ATTTGTTTACATATCATCTATGG - Intergenic
915158717 1:153900787-153900809 ATTTTTTTTCATATTGTCTTTGG - Intronic
915187087 1:154115383-154115405 ATTCATTTACATATTGTCTGTGG - Intronic
915242609 1:154534134-154534156 ATTTGTTTACAGATTGCCTGTGG + Intronic
915670446 1:157484616-157484638 ATTTGTTTACATATTTTATTTGG + Intergenic
915699253 1:157775188-157775210 ATTCGTTTACATATGGTCTATGG + Intronic
915961908 1:160274011-160274033 ATTTATTTACATATTGTCTGTGG - Intergenic
916243270 1:162660826-162660848 ATGTATTTACATATTGTCTGTGG + Intronic
916308456 1:163366769-163366791 ATTTGCTTACATTTTGTCTGTGG + Intergenic
916362073 1:163981806-163981828 ATTTGTTTACATATTGTCTATGG + Intergenic
916404420 1:164483656-164483678 ATTTGTTTACATATTGTCTATGG - Intergenic
916465443 1:165069958-165069980 CTTTGTTTACATATTGTCTATGG - Intergenic
916837915 1:168567724-168567746 ATTTGCTTACATATTGGCTATGG - Intergenic
916901670 1:169231321-169231343 ATCTGTTTCCATACTTTCAGGGG - Intronic
916988745 1:170219372-170219394 ATTTGTTTACATATTGTCTCTGG + Intergenic
917150942 1:171944110-171944132 ATTCATTTATATATTGTCTGTGG - Intronic
917323270 1:173806066-173806088 ATTTGCTTATATATTGTCTGTGG - Intronic
917543451 1:175937587-175937609 ATTTGTTTACATTTTCTCTAGGG + Intergenic
917603818 1:176604542-176604564 ACTTGTTTACATATTGTCTATGG + Intronic
917740385 1:177956217-177956239 ATTCATTTACATATTTTCTGTGG + Intronic
918148289 1:181776937-181776959 ATTCGTTTACGTATTGTCTCTGG + Intronic
919085245 1:192913124-192913146 ATTTGTTTACATATTGTCTGTGG + Intergenic
919405135 1:197170737-197170759 ATCTGTTTACACATTGTCTATGG + Intronic
919604277 1:199661830-199661852 ATTTGTTTATATATTGTCTTTGG - Intergenic
919630831 1:199958973-199958995 ATTCGTTTACATATTGCCTATGG + Intergenic
919709793 1:200714714-200714736 GTTTGTTTACATACTGAGTTAGG - Intergenic
919863738 1:201762574-201762596 ATTTGTTTACATACTATCTATGG + Intronic
919868281 1:201800474-201800496 ATTAATTTACATAATGTCTGTGG + Intronic
919964520 1:202508983-202509005 ATTTAGTTACATATTGTCTGTGG - Intronic
920266512 1:204727802-204727824 ATTTGTTTACGTATTGTCTGTGG - Intergenic
920308447 1:205033603-205033625 ATTCATTTATATATTGTCTGTGG - Intergenic
920725270 1:208428992-208429014 ATTTATTTAATTTCTGTCTGTGG - Intergenic
920902413 1:210124094-210124116 ATTTGTTTTCATATTGTCTATGG + Intronic
921032024 1:211342148-211342170 ATTCATTTACATATTGTCTATGG - Intronic
921122087 1:212146020-212146042 ATTTATTTGCATATTGTCTATGG + Intergenic
921399787 1:214708463-214708485 ATTTGTTTAAGTACACTCTGTGG - Intergenic
921431985 1:215076626-215076648 ATTAGGTTACAAACAGTCTGGGG - Intronic
921526252 1:216222304-216222326 AATTCTTTACATATTTTCTGTGG - Intronic
921537147 1:216365801-216365823 ATTTGTTTATATATTGTCTGTGG - Intronic
921751826 1:218803512-218803534 ATTTGTTTATATATTGTCTGTGG + Intergenic
921809344 1:219494310-219494332 ATTTGTTTATGTATTGTCTATGG - Intergenic
921926516 1:220714408-220714430 ATTTGTGTACATATTTTGTGTGG + Intergenic
922075745 1:222242491-222242513 ATTTATTTACATACTATTTATGG + Intergenic
922084665 1:222334745-222334767 ATTTCTTTACATACTCTCTATGG + Intergenic
922114380 1:222597019-222597041 ATTCATTTACATATTGTCTGTGG - Intergenic
922125461 1:222716629-222716651 ATTTATTGACATACTGTGTATGG + Intronic
922381350 1:225031382-225031404 ATTTGTTTACCCATTGTCTGTGG + Intronic
922711898 1:227840542-227840564 ATTTATTTACATATTGTCTCTGG + Intronic
922884824 1:229010313-229010335 ATTTGTTTACATGTGGTCTGTGG - Intergenic
923112201 1:230900873-230900895 ATGTGTTCACATACATTCTGGGG + Intergenic
923120601 1:230986584-230986606 ATTGGGTTCCATACTATCTGTGG - Intronic
923321095 1:232834289-232834311 ATTCATTTTCATATTGTCTGTGG - Intergenic
923321947 1:232843089-232843111 ATTAATTTAAATACAGTCTGAGG + Intergenic
923577208 1:235170234-235170256 ATTTGTTTACATATTGCCTATGG + Intronic
923669793 1:236030569-236030591 ATTCATTTATATATTGTCTGTGG + Intronic
923733279 1:236575401-236575423 ATTTGTTTACACCCTGTCTGTGG + Intronic
923833620 1:237585078-237585100 GTTTGTTTACCTACTGTCTATGG + Intronic
923901516 1:238331082-238331104 TATTGTTTACATATTGTCTGTGG + Intergenic
924233266 1:241979721-241979743 ATTTATTTACTTATTGTCTCTGG + Intergenic
924392072 1:243572261-243572283 ATTCATTTACATACTATCTGAGG + Intronic
924451148 1:244180240-244180262 ATTTGTCTATATACTGTCAATGG + Intergenic
924623074 1:245679184-245679206 ATTTGTTTACATAGTGTCTGTGG - Intronic
924662868 1:246037995-246038017 ATTTGTTTGCATATTGTTTGTGG - Intronic
1062901243 10:1148423-1148445 ATTCATTTGCATACTGTCTATGG - Intergenic
1063435868 10:6029509-6029531 ATTTATTTACATTTTGTCTATGG + Intronic
1063620849 10:7647278-7647300 ATTCATTTACATACTGTCTATGG + Intronic
1063718959 10:8559024-8559046 ATCTGTTTGCATAATGGCTGAGG - Intergenic
1063890101 10:10620205-10620227 ATTTGTTTACATACAATCTAAGG + Intergenic
1063895906 10:10681500-10681522 ACTTGTTTATATATAGTCTGTGG - Intergenic
1064002899 10:11678297-11678319 AGCTGTTCACATATTGTCTGTGG + Intergenic
1064046310 10:12019265-12019287 ATTTGTTTACATATTGTCTGTGG - Intronic
1064476662 10:15697623-15697645 ATTATTTAACATACTGTCTATGG - Intronic
1064540335 10:16398480-16398502 ATTTGTTAGCACACTGGCTGTGG + Intergenic
1065063821 10:21938592-21938614 ATTTGTGTATGTATTGTCTGTGG - Intronic
1065795141 10:29300020-29300042 ATTCATTTACATACTTTCTATGG - Intronic
1066593190 10:37018560-37018582 ATTTGTCTTCATATTGTCTGTGG - Intergenic
1067020217 10:42790161-42790183 ATTCATTTACATATTGTCTATGG - Intronic
1067075212 10:43175208-43175230 ATCTGTTTACAAATTGTCTATGG - Intronic
1067292798 10:44956616-44956638 TTTGGTTTACATATTGTCTATGG + Intergenic
1067499944 10:46794564-46794586 ATTCATTTACATATTGTCTATGG - Intergenic
1067520874 10:47003645-47003667 ATTTGTTTACATATTGTCTGTGG + Intergenic
1067594688 10:47545761-47545783 ATTCCTTTACATATTGTCTATGG + Intronic
1067641797 10:48053876-48053898 ATTCCTTTACATATTGTCTATGG + Intergenic
1067749183 10:48958659-48958681 AGATGTTTACATTCTGTGTGAGG + Intronic
1068039196 10:51801231-51801253 ATTCATTTACATATTGTCTCTGG - Intronic
1068587780 10:58819114-58819136 ATTTGTTTACATATTGTCTATGG + Intronic
1068604944 10:58994979-58995001 ATTTGTTTATATGCACTCTGTGG - Intergenic
1068621121 10:59184237-59184259 ATTTGTTTACATACTGTCTATGG + Intronic
1068875138 10:61987662-61987684 ATTCATTTACATATTGTCTTTGG - Intronic
1069011799 10:63382313-63382335 AATTGTTTACATATTGTCTGTGG - Intronic
1069037508 10:63660777-63660799 ATTTGTTTACATATTATCTGTGG - Intergenic
1069337844 10:67374229-67374251 ACTTGTTTACTTATTGTCTGTGG - Intronic
1069373669 10:67772310-67772332 ATTTGTTTACAGATTATCTATGG - Intergenic
1069840076 10:71334280-71334302 ATTTGTTTACATGTTGTCAAGGG - Intronic
1070035256 10:72716106-72716128 ATTTGTTTACAGATTGTCTGTGG + Intronic
1070047640 10:72854792-72854814 ATTTGTTTACATATTGCCTGTGG + Intronic
1070055867 10:72934241-72934263 ATTTGTTTACATATTCTCTGTGG - Intergenic
1070232017 10:74578523-74578545 ATTTGTTTCCATATTATCTATGG - Intronic
1070482663 10:76899538-76899560 ATTTGTTTATGTATTGTCTGGGG + Intronic
1070541899 10:77421544-77421566 CTTTGTTTATATATTGTCTAAGG - Intronic
1070546966 10:77460062-77460084 ATTTGTTTACATATTGCCTATGG - Intronic
1070690982 10:78525214-78525236 ATTTGTTTATGTAATGTCTAGGG + Intergenic
1070897728 10:79999339-79999361 ATTTATTTACCTATTGTCTATGG + Intergenic
1070981033 10:80647595-80647617 ATTTGTTTACATATTGTCTTTGG + Intergenic
1071394803 10:85212739-85212761 ATTTGTTTACGTGCTGTCTATGG - Intergenic
1071435166 10:85642190-85642212 ATTTATTTACATGCTGTTTATGG - Intronic
1071456696 10:85856714-85856736 ATATGTTTATATATTGTCTATGG - Intronic
1071745168 10:88410008-88410030 ATTCATTTACACATTGTCTGTGG - Intronic
1071837934 10:89438321-89438343 TTTTGTTTACATATTGTCTGTGG + Intronic
1071974951 10:90946132-90946154 TATTGTTTACATATTGCCTGTGG + Intergenic
1072028129 10:91485688-91485710 ATTCATTTACATCCTGTCTAAGG - Intronic
1072514285 10:96163700-96163722 ATTCATTTACATATTGTCTATGG - Intronic
1072545710 10:96436176-96436198 ATTTATTGACATATTATCTGTGG - Intronic
1072557526 10:96532678-96532700 ATTTGTTTACATATTCTCTGTGG - Intronic
1072865723 10:99058982-99059004 ATTCATTTACATATTGTCTATGG - Intronic
1072993585 10:100222690-100222712 ATTTCTTTACACATTGTCTATGG - Intronic
1073334026 10:102691470-102691492 ATTTGTTTACAGATTTTCTGTGG - Intronic
1073634592 10:105184242-105184264 ATTTGTCTCCATACTGTCTATGG - Intronic
1073706131 10:105986647-105986669 ATTTGTTTACATATTGTCTATGG - Intergenic
1074034732 10:109726895-109726917 ATTCGTTTACTTATTGTCTTTGG + Intergenic
1074142138 10:110682469-110682491 ATTTATTTACATATTGTCTGAGG - Intronic
1074297300 10:112202226-112202248 ATTTTCTTATATACTGTCTAAGG - Intronic
1074542339 10:114375230-114375252 TTTTGTTTACATAGTATCAGTGG + Intronic
1074625075 10:115174676-115174698 ATTTGTTTATCTATTGTCTATGG - Intronic
1074632893 10:115278644-115278666 GTTTGTTTACATACTATATCAGG + Intronic
1075149063 10:119910107-119910129 ATTGGTTTACACATTGTCTCTGG - Intronic
1075191313 10:120311657-120311679 ATTGATTTACATATTGTCTATGG + Intergenic
1075228506 10:120650882-120650904 ACCTGTTTGCATATTGTCTGTGG - Intergenic
1075292708 10:121243993-121244015 ATTTGTTTACATATTGTCTCTGG - Intergenic
1075319710 10:121481038-121481060 ATCTATTTACATATTGTCTGTGG + Intronic
1075358586 10:121807910-121807932 ATTTGTTCACACACTGCCTGTGG + Intronic
1075503421 10:122999535-122999557 ATTTGTTTACATACTGTCTGTGG - Intronic
1075566377 10:123507571-123507593 GTTTGTTTACATACTGAATTAGG + Intergenic
1076331310 10:129671475-129671497 ATTTGTTTATGTCTTGTCTGTGG + Intronic
1076644004 10:131939013-131939035 ATGTGTGCACATACTGTCTCTGG - Intronic
1077796498 11:5498098-5498120 GTTTGGTTCCATACTGTCTTAGG - Intronic
1078167275 11:8898671-8898693 ATTCATTTACATATTGTCTATGG + Intronic
1078176051 11:8971685-8971707 ATTTATTTACATATTGCCTCTGG + Intergenic
1078468221 11:11566282-11566304 ATTGATTTACATATTGTCTCTGG - Intronic
1078624990 11:12947216-12947238 ATTTCGTTACTTATTGTCTGTGG + Intergenic
1078627653 11:12972179-12972201 ATTTGTTTACATATTGTCTATGG + Intergenic
1078649336 11:13172816-13172838 ATTCATTTACATATTGTCTATGG + Intergenic
1079365261 11:19803477-19803499 ATGTGTTCAAATCCTGTCTGTGG + Intronic
1079436540 11:20459086-20459108 ATTTGTTTACATGTTGTCTATGG - Intronic
1079508274 11:21179977-21179999 ATTTGTTTACATATATTCTGTGG - Intronic
1079522413 11:21343689-21343711 ATTAATTTACATATTGTCTTTGG - Intronic
1079981152 11:27152738-27152760 ATTCATTTACATATTGTCTTTGG - Intergenic
1080108148 11:28534048-28534070 ACTTGTTTACATGTTGTCTGTGG - Intergenic
1080287307 11:30630135-30630157 CTTTCTTTACTTACTGTGTGTGG - Intergenic
1080294213 11:30706580-30706602 ATTCATTTACATATTGTCTATGG - Intergenic
1080738775 11:35044011-35044033 ATTTGTTTACATACTAAATTAGG - Intergenic
1080776412 11:35391177-35391199 GCTTATTTACATACTGTCCGTGG + Intronic
1080815066 11:35747724-35747746 ATTAGTTTACTCACTGGCTGTGG + Intronic
1080991517 11:37542509-37542531 AATTGTTTATATATTGTCTGTGG + Intergenic
1081150592 11:39625566-39625588 ATTTGTTTACATATCATCTATGG + Intergenic
1081341229 11:41930100-41930122 ATTTGTTTACATTTTATCTATGG - Intergenic
1081476823 11:43441329-43441351 ATCTGTTTAAATCCTGTCTCAGG + Intronic
1081903770 11:46652966-46652988 CTTTGTTTACATATTGTCTATGG + Intronic
1082096189 11:48131640-48131662 ATTTGCTTATGTACTGTCTATGG + Intronic
1083014974 11:59443828-59443850 CTATGGTTACATAGTGTCTGCGG + Exonic
1083247498 11:61440778-61440800 ATTCGTTTACCTGCTATCTGTGG - Intronic
1083265302 11:61544048-61544070 ATTAGTTTACATAGTGACTCTGG + Intronic
1084337532 11:68469173-68469195 ATTTGTTTACAGATTGGCTATGG - Intronic
1084602323 11:70153281-70153303 ATGTGTTTACCTACTGTCTATGG - Intronic
1084904094 11:72332661-72332683 ATTAGTTTACTTTCTGTCTATGG + Intronic
1085002295 11:73050157-73050179 ATTTGTTTACATATTGTCTATGG - Intronic
1085108444 11:73866298-73866320 ATTCACTTACATACTGTCTCTGG + Intergenic
1085135134 11:74079984-74080006 ATTAATTTACATAGTGTCTGTGG - Intronic
1085144535 11:74181868-74181890 ATTCAGTTACATATTGTCTGTGG - Intronic
1085226404 11:74924894-74924916 ATTTGTTTACATATTGTCTATGG + Intronic
1085497111 11:76979787-76979809 ATTTATTTACATATTATCTGTGG - Intronic
1085556145 11:77423780-77423802 ATTCATTTACATATTGTCAGTGG - Intronic
1085584695 11:77690852-77690874 ATTTGTTTGTATATTGTCTGTGG - Intronic
1085625584 11:78069660-78069682 ATTTGTTTACATGTTGTTTATGG - Exonic
1085895113 11:80629765-80629787 ATTTGTTTTCATATTGTCTGTGG + Intergenic
1086003578 11:82009571-82009593 ATTTGTTTACATATTGTCTAAGG + Intergenic
1086473541 11:87144409-87144431 ATTTGTTTACCTATTGTCTATGG - Intronic
1086733320 11:90275591-90275613 ATTTGATTACATATTGTCTATGG - Intergenic
1086878629 11:92128292-92128314 CTTTGTTTATATATTGTCTATGG - Intergenic
1087081192 11:94172575-94172597 ATTTGTTCACACATTATCTGTGG + Intronic
1087130668 11:94667036-94667058 ATTTGTTTAAGTATGGTCTGTGG + Intergenic
1087215339 11:95487388-95487410 AGTTGTTTAAATACTGTATGAGG - Intergenic
1087466475 11:98513375-98513397 ATTGGTTTACATATTGTCTATGG - Intergenic
1087611981 11:100445904-100445926 ATTTATTTATGTATTGTCTGTGG + Intergenic
1087912582 11:103770810-103770832 ATTTGTTTAAATATTGTCTATGG + Intergenic
1087949176 11:104199142-104199164 ATTCATTTACATATTGTCTATGG - Intergenic
1088205223 11:107384680-107384702 ATTCATTTACATACTGTGTATGG + Intronic
1088289950 11:108225290-108225312 ATTTGATTATATACTTCCTGTGG - Intronic
1088480304 11:110290783-110290805 ACTTGTTTACATATTATCTATGG - Intronic
1088962808 11:114686729-114686751 AATTGCTTACATACTGTTGGTGG - Intronic
1089111213 11:116058649-116058671 GTTTGTTTATATATTGTCTGTGG - Intergenic
1089131232 11:116213767-116213789 ATTTATTGACATATTGTCTGTGG + Intergenic
1089803560 11:121060883-121060905 TTTTGGTTACAGAATGTCTGTGG + Intronic
1089828535 11:121302641-121302663 AGATGTTTACATACTGTCTGTGG - Intronic
1089860611 11:121587052-121587074 ATTTGTTTACATATTGTATATGG + Intronic
1089897302 11:121943656-121943678 ATTTATTTGCATACTGTTTATGG - Intergenic
1089959741 11:122605456-122605478 ATATATTTAAATGCTGTCTGTGG + Intergenic
1090082189 11:123621266-123621288 ACATATTTACATACTGTCTCTGG - Intronic
1090097526 11:123757592-123757614 ATCTGTTTACCTATTGCCTGTGG + Intergenic
1090545325 11:127759424-127759446 ATTTTTTTAAATACTTTCAGTGG + Intergenic
1090548610 11:127793433-127793455 ATTTGTTTAAATATTATCTGTGG - Intergenic
1090634280 11:128680465-128680487 ATTTTATTACATAATCTCTGAGG - Intergenic
1090810704 11:130239469-130239491 ATTTGCTGACATATTGTTTGTGG - Intronic
1090947622 11:131445883-131445905 ATTAATTGACATACTGTCTATGG + Intronic
1091115778 11:133011936-133011958 ATTTGTTTACAAACTGTCTGTGG - Intronic
1091850901 12:3696116-3696138 ATTTGTTCACATATTGCCTATGG + Intronic
1091957127 12:4655215-4655237 ATTTGTGTACATATTGTCTATGG - Intronic
1092867006 12:12770914-12770936 TCTTGCTTGCATACTGTCTGAGG - Intronic
1093139411 12:15490397-15490419 ATTTGTTTATGTATTGTGTGTGG - Intronic
1093226105 12:16485556-16485578 ATTTGAATACATAATGTCTGAGG - Intronic
1093354243 12:18145002-18145024 ATTTCTTTAAATATTGTTTGAGG - Intronic
1093526273 12:20106576-20106598 ATTTGTTTATATATTATCTATGG - Intergenic
1093637260 12:21486152-21486174 ATTTGTTGACATGTTGTCTATGG - Intronic
1093637540 12:21489241-21489263 ATGTGTTTACACATTATCTGTGG + Intronic
1093730666 12:22562199-22562221 ATTTGTTTATATATTATCTGTGG + Intergenic
1094032663 12:26030894-26030916 ATTCATTTACGTACTGTCTATGG - Intronic
1094074865 12:26461432-26461454 ATTTGTTTACATATTGTCTATGG + Intronic
1094470727 12:30798769-30798791 TTTTGTTTACATATTGTCTATGG - Intergenic
1094643600 12:32300008-32300030 ATTTGTTTACATGTTGTCTATGG - Intronic
1094687329 12:32730530-32730552 ATTTATTTACATATTGTCTATGG + Intronic
1094732101 12:33188853-33188875 ATTTGTTTATATATTTTTTGTGG + Intergenic
1095280352 12:40344663-40344685 ATTTGTTTACATTATGTCACAGG + Intronic
1095415522 12:41972863-41972885 ATTTGTTTACATATTGTCTATGG - Intergenic
1095727888 12:45472715-45472737 ATTGATTTACATACTGTCTGTGG - Intergenic
1096744940 12:53720289-53720311 ATTCGTTTACATACTGTCAATGG - Intronic
1097048067 12:56202492-56202514 ACTTGTTTATATATTGTCTGTGG - Exonic
1097805959 12:63965242-63965264 ATGTGTTCATATACTGTCTTTGG - Intronic
1097900823 12:64872363-64872385 ATTTGTTTACAGGTTGTCTAAGG + Intronic
1097983937 12:65763030-65763052 ACTTGTTTACATGTTGTTTGTGG + Intergenic
1098231653 12:68377410-68377432 ATTTATTCACATACTGTCTATGG + Intergenic
1098370569 12:69755920-69755942 ATTCATTTACATACTGTCTATGG - Intronic
1098377349 12:69831266-69831288 ACTCTTTTACATATTGTCTGTGG + Intronic
1098513740 12:71349576-71349598 ATTTGTTTACATGTTGTCTAAGG - Intronic
1098949902 12:76629265-76629287 ATTTGTTTACACACTGTCTGTGG - Intergenic
1098950020 12:76630452-76630474 ATTTGTTTACATACTGTTTGTGG + Intergenic
1098985045 12:77003012-77003034 ATGTGTGTACGTATTGTCTGTGG - Intergenic
1099159199 12:79219207-79219229 ATTTGTTTTCTTGCTGTTTGAGG + Intronic
1099680362 12:85820235-85820257 ATTTGTTTACATATTGTACATGG + Intronic
1099743127 12:86667637-86667659 ATTTGTTTACATATGGTCTGTGG - Intronic
1099896246 12:88651055-88651077 ACTTGTTTACATATTGTCTATGG + Intergenic
1099993218 12:89749495-89749517 ATTTATTTAAATATTGTCTATGG - Intergenic
1100010201 12:89943611-89943633 ATTTGTTTATGTAATGTCTATGG + Intergenic
1100017150 12:90024666-90024688 TTCTGTTTACTTACTGTATGTGG + Intergenic
1100163982 12:91895146-91895168 ATTTGTTTACATATGGTCTATGG + Intergenic
1100192568 12:92208572-92208594 GTTTGTTTACATGTTCTCTGTGG + Intergenic
1100224715 12:92544567-92544589 ATTCATTTACATATTGTCTATGG + Intergenic
1100312034 12:93404939-93404961 ATTTGTTTACAAATCGTCTGTGG + Exonic
1100364631 12:93908485-93908507 ATTTGTTTACATATTGTCTATGG + Intergenic
1100709195 12:97236195-97236217 ATTTGTTTAAAAATTATCTGGGG + Intergenic
1100967069 12:100024245-100024267 ATTCATTTACATATTGTCTGTGG + Intergenic
1101005104 12:100393983-100394005 ATTTGTTTCCATATTGTCTCTGG - Intronic
1101042840 12:100773970-100773992 ATTTGTTTTCATATTGTCTATGG + Intronic
1101053339 12:100886703-100886725 ATTCGTTTATGTATTGTCTGTGG + Intronic
1101073435 12:101101012-101101034 ATTTATTTACATATTATTTGTGG + Intronic
1101142545 12:101811293-101811315 ATTTATTTACATGCTGTCCGTGG - Intronic
1101218896 12:102616006-102616028 ATTTGTTTATGTATTGTCTCTGG + Intergenic
1101547886 12:105733814-105733836 CATTGTTTACCTACTGTCTATGG + Intergenic
1101568259 12:105930152-105930174 ATTCTTTTACATATTGTCTGTGG - Intergenic
1101577688 12:106013241-106013263 ATTCATTTCCATATTGTCTGTGG + Intergenic
1101747183 12:107551609-107551631 ATTTGTTTACATATTATTTATGG + Intronic
1101967129 12:109289295-109289317 ATTCATTTACATATTGGCTGTGG + Intronic
1101993448 12:109506660-109506682 GTTTCTTTACACATTGTCTGTGG + Intronic
1102187333 12:110959096-110959118 ATTTGTTAACATATTGTCAAAGG - Intergenic
1102401680 12:112635179-112635201 ACTTGGTTACATATTGTCTATGG - Intronic
1102478530 12:113204510-113204532 ATTCATTTACATATTGTTTGTGG + Intronic
1102486431 12:113260807-113260829 AATTCTTTACATACTGAATGCGG + Intronic
1102563894 12:113782009-113782031 ATTTGTTTACGTACCGTTTATGG + Intergenic
1102620125 12:114187937-114187959 ATTTGTTTACATAGCATCTATGG - Intergenic
1102630466 12:114274352-114274374 ATTTGTTTATGTATTGTCTATGG - Intergenic
1102730966 12:115109402-115109424 ATTTGGCTACATATTGTCTATGG - Intergenic
1102851369 12:116248663-116248685 ATTTATTTGCATATTGTCTGTGG + Intronic
1102909073 12:116698805-116698827 ATTGGTTTACATATTGTTTCTGG + Intergenic
1103039090 12:117679901-117679923 ATTTATATACATATTGTCTGTGG + Intronic
1103045794 12:117733514-117733536 ATTTATTTGCACACTGTCTACGG + Intronic
1103083814 12:118046070-118046092 ATTTGGTTAGGTATTGTCTGAGG + Intronic
1103237897 12:119389335-119389357 ATTTCTTTACATATGGTCTATGG + Intronic
1103259238 12:119571937-119571959 ATTTGTTTACATATTGTTTTTGG - Intergenic
1103279659 12:119746317-119746339 GTTTGTTTACATATCGTTTGTGG - Intronic
1103338198 12:120205728-120205750 ATTCGTTTACACATTGTCTATGG + Intergenic
1103428570 12:120861226-120861248 ATTTGTTTACATATCATCTATGG - Intronic
1103483005 12:121263450-121263472 ATTTGTTTACATCATGTGTGTGG + Intronic
1103575631 12:121875182-121875204 ATTTGTTCACCTATTGTCTGTGG - Intergenic
1103672997 12:122633528-122633550 GTTTGTTTACATATTATCTGGGG + Intergenic
1103849553 12:123923256-123923278 ATTTGTATACATATTGTCTATGG + Intronic
1103870454 12:124087440-124087462 ATGTGTTTACATACTGCCTATGG - Intronic
1103940575 12:124499334-124499356 ATTTATTTACATACACACTGTGG + Intronic
1104157285 12:126145742-126145764 ATTTATTTGCATATTGTCTGTGG + Intergenic
1104319677 12:127738775-127738797 ATTTGTTTTCATTGAGTCTGAGG + Intergenic
1104578611 12:129991606-129991628 ATTTGTTTAACTAATGTCTATGG - Intergenic
1104666655 12:130652271-130652293 ACTTGTTTACATAGTATCTATGG + Intronic
1104713170 12:130999236-130999258 ATTTGTTTGCATATTGTCTGTGG + Intronic
1105237621 13:18573219-18573241 ATTCATTTACAAACTGTCTATGG + Intergenic
1106036013 13:26046368-26046390 AGATGTTTTCATACAGTCTGGGG + Exonic
1106071061 13:26411324-26411346 ATTTGTTTACTATCTGTCTCTGG + Intergenic
1106364617 13:29066522-29066544 ATTCATTTACATATTGTCTGTGG - Intronic
1106497147 13:30289894-30289916 AGTTGTTTACAAATTGTCTCTGG - Intronic
1106565876 13:30884166-30884188 ATTTGTATACATATTATCTTTGG - Intergenic
1106616550 13:31335387-31335409 ATTTGTTTGCATATTGTCTATGG + Intergenic
1106820189 13:33456079-33456101 ATTTGTTTATATATTGTCTATGG + Intergenic
1106939737 13:34764574-34764596 ATTCATTTACATATTTTCTGTGG + Intergenic
1106969026 13:35113794-35113816 ATTCGTTTACATACTGTCTGTGG - Intronic
1106981225 13:35284083-35284105 ATTTGTTTATGTATTGTCTATGG + Intronic
1107024183 13:35782945-35782967 ATTCATTTACAAACTGTCTATGG - Intronic
1107074105 13:36302445-36302467 ATTTGTTTACATATTGGCTATGG - Exonic
1107089196 13:36458259-36458281 ATTGGTTTACATACTGTCTGTGG - Intergenic
1107119972 13:36785625-36785647 ATTTCTTTACATATTGCCTGTGG - Intergenic
1107365269 13:39665974-39665996 TTGTGTTTACATACTGTCTATGG + Intronic
1107422710 13:40263844-40263866 ATTCATTTACATAGTGTCTATGG + Intergenic
1107440531 13:40423473-40423495 TTTTATTAACATACTGTCTCTGG - Intergenic
1107643589 13:42470767-42470789 ATTTGTTTATATATTGTCCATGG - Intergenic
1107985555 13:45773039-45773061 ATTCATTTACATATTGTCTATGG + Intergenic
1108011593 13:46019303-46019325 ATTTGGTTACATATTGTCTGTGG - Intronic
1108119361 13:47166530-47166552 ATTTGTTTATATATTGTCTATGG + Intergenic
1108235980 13:48405555-48405577 ATTCATTTATATATTGTCTGTGG + Intronic
1108372094 13:49780233-49780255 ATTTGTTTGCCTACAGTCTATGG + Intronic
1108701517 13:52948139-52948161 ATTTGTTTACATTAGGTCTGGGG + Intergenic
1108745294 13:53387320-53387342 ATTTGTTTATGTATTGTCTGTGG + Intergenic
1109051633 13:57490235-57490257 ATTAGTTTCCATATTGTCTATGG - Intergenic
1109245504 13:59949599-59949621 ATTAGTTTATATAGAGTCTGTGG + Intronic
1109333775 13:60966117-60966139 AATCATTTACATATTGTCTGTGG - Intergenic
1109592579 13:64505553-64505575 ATTTGCTTACATATTGTCTATGG - Intergenic
1109714616 13:66205083-66205105 ATTGGTTCACGTTCTGTCTGTGG - Intergenic
1109842980 13:67945489-67945511 AGTTGCTTACATATTGTCTGTGG - Intergenic
1109870830 13:68330295-68330317 ATATGTCAATATACTGTCTGTGG - Intergenic
1109942798 13:69393392-69393414 ATTTCTTACCATACTGTCTATGG - Intergenic
1109975090 13:69821024-69821046 ATTTGTTTACCTGTTGTCTGTGG - Intronic
1109998260 13:70158681-70158703 ATTTGTTTATATACTGTCTATGG - Intergenic
1110191995 13:72740703-72740725 ATTCATTTACATATTGTCAGCGG - Intronic
1110193495 13:72758419-72758441 ATTTGTTTACATATTGTATATGG + Exonic
1110203310 13:72879890-72879912 ATTTGTTTACATATTGTCTATGG + Intronic
1110531334 13:76602232-76602254 ATTTATTTGCATATTGTCTGTGG + Intergenic
1110624129 13:77632556-77632578 ATTTGTTCACATATTATCTCTGG - Intronic
1110925254 13:81142677-81142699 ATTTCTTTACATACTGCCTATGG - Intergenic
1111425485 13:88075066-88075088 TGTTGATTACATAATGTCTGTGG + Intergenic
1111459676 13:88522583-88522605 ATTCATTTACACATTGTCTGGGG - Intergenic
1111573626 13:90119751-90119773 ATTTGTTTATATGGTGTTTGGGG - Intergenic
1112181612 13:97087866-97087888 ACTTGTTTATATATTGTCTATGG - Intergenic
1112384734 13:98928698-98928720 ATTTGTTTACATATTGCCTATGG - Intronic
1112388090 13:98958568-98958590 ATGTGTTTACTTATTGTCTGTGG - Intronic
1112531866 13:100212266-100212288 ATCCCTTTACATATTGTCTGTGG + Intronic
1112645593 13:101327979-101328001 ATTTGTTTAGACATGGTCTGTGG - Intronic
1112773975 13:102824628-102824650 ATTTGTTTACATGTTGTCTATGG - Intronic
1112903193 13:104384804-104384826 ATTTGTTTACATATTATCTATGG - Intergenic
1113077072 13:106477487-106477509 ATTTGTTTACTTATGGTCTACGG + Intergenic
1113535184 13:111060754-111060776 ATTTGTTTCTATATTGTCTGTGG + Intergenic
1113833087 13:113312364-113312386 ATTTATTTACACATTATCTGTGG + Intronic
1114509807 14:23249000-23249022 ATTTGCTTACATGCTGTCTGTGG - Intronic
1114590843 14:23863414-23863436 ATGAGTGTACATACTGACTGAGG + Intergenic
1114770242 14:25422485-25422507 CATTCTTTACATATTGTCTGTGG + Intergenic
1114792846 14:25679363-25679385 ATTGATTTACATATTGTCTGTGG - Intergenic
1115274879 14:31596526-31596548 ATTTATTTACATATTGTTTATGG + Intronic
1115380980 14:32738860-32738882 ATTCATTTAGATATTGTCTGTGG - Intronic
1115422785 14:33216663-33216685 TTTTGTTTACATATTGTCTATGG - Intronic
1116105209 14:40493998-40494020 ATCTGTTTACCTATTGTCTATGG - Intergenic
1116358410 14:43961187-43961209 ATTTGTTTACCTATTGTCTGTGG - Intergenic
1116464272 14:45213608-45213630 ATTTGTTTGTATATTGTCTATGG - Intronic
1116507404 14:45701529-45701551 ATTTGTTTGCGTATTGTCTGTGG + Intergenic
1116574789 14:46558920-46558942 ATTCATTTACATATTGTCTATGG + Intergenic
1117036597 14:51736020-51736042 ATTTGTTTACATATTGACGATGG - Intergenic
1117604194 14:57408803-57408825 ATTTGTTTACATGATGTCTGTGG - Intronic
1117781443 14:59236981-59237003 TCCTGTTTACATATTGTCTGTGG - Intronic
1117987659 14:61404383-61404405 ATTTGTTTACAAAATGTCCTGGG + Intronic
1118038949 14:61897140-61897162 ACTTGTTTACGTATTGTCTATGG + Intergenic
1118120470 14:62834841-62834863 AATTATTTACATACTGTCTATGG + Intronic
1118451400 14:65905845-65905867 ATTTGCTTACATATTGTCTATGG + Intergenic
1118713607 14:68543154-68543176 ATTTGTTTACATATTGCCTATGG - Intronic
1119204842 14:72786480-72786502 ATCCGTTTACATATTGTCTGTGG + Intronic
1119449446 14:74696051-74696073 ATTCATTTACATATTATCTGTGG + Intronic
1119660268 14:76446133-76446155 ATTTGTTTGTATATTGTCTATGG + Intronic
1119935225 14:78586114-78586136 ATTTCTTTATCTATTGTCTGTGG + Intronic
1119953323 14:78768813-78768835 ATTAGTTTCCATGCTGTCTCTGG + Intronic
1120001084 14:79303737-79303759 ACTTCTTTACTTATTGTCTGTGG - Intronic
1120156852 14:81102652-81102674 ATTTGTTTATATATTGTCTATGG - Intronic
1120187247 14:81406451-81406473 ATTAGTTTACATATTGTCTATGG + Intronic
1120290693 14:82566474-82566496 GTTTGTTGACACACTGTCTTGGG + Intergenic
1120332640 14:83113274-83113296 ACTTTTTTCCATACTGTCTTGGG + Intergenic
1120614503 14:86686554-86686576 GTTTGTTTACATGTTGTCTGTGG + Intergenic
1120656600 14:87197746-87197768 ACTTGTTTACATATTATCTATGG - Intergenic
1120772344 14:88394135-88394157 AATCTTTTACATATTGTCTGTGG + Intronic
1121286187 14:92737766-92737788 TTTTGTTTATATATTGTCTCTGG - Intronic
1121360142 14:93249633-93249655 ATTCATTTACGTACTGTCTACGG + Intronic
1121459301 14:94061776-94061798 ATTTGGTTTTATATTGTCTGTGG - Intronic
1121478676 14:94239644-94239666 ATTTGTTCACATATTGTCTGTGG + Intronic
1121545379 14:94759326-94759348 ATTTATTTATGTATTGTCTGTGG - Intergenic
1121642865 14:95497726-95497748 ATTTATTTACATGCTATCTGTGG - Intergenic
1121652692 14:95571383-95571405 ATTTGTTTACGTATTGGCTATGG - Intergenic
1121657631 14:95609400-95609422 ATTTGTTTCTATTTTGTCTGTGG + Intergenic
1123483932 15:20666610-20666632 ATTCATTTACATACAGTCTGTGG + Intergenic
1123725313 15:23095692-23095714 ATTCATTTACCTACTGTCTGAGG - Intergenic
1124239577 15:28018635-28018657 ATTTCTTCACACACTGTCAGAGG - Intronic
1124269046 15:28264265-28264287 ACTCATTTACGTACTGTCTGTGG - Intronic
1124478407 15:30057226-30057248 ATTCATTTACATATAGTCTGTGG - Intergenic
1124808067 15:32906425-32906447 ATTTGTTTATATACTGCCTGTGG + Intronic
1125034459 15:35107721-35107743 ATTCATTTACATATTGTCTGTGG - Intergenic
1125207262 15:37167747-37167769 ATTCATTTACATATTGTCTCTGG + Intergenic
1125384426 15:39122239-39122261 ACTTTCTAACATACTGTCTGAGG + Intergenic
1125440402 15:39696608-39696630 ATTTGTTTAATTATTGTCTTAGG - Intronic
1125469444 15:39988526-39988548 ATTGGTTTACATATTGCCTATGG + Intronic
1125826351 15:42679741-42679763 ATTTATTTACGTACTGTCTAGGG - Intronic
1125907464 15:43406487-43406509 ATTTGTTTACTCATTGTCTATGG + Exonic
1126012666 15:44318096-44318118 ATTTGTTTACATATTGTATGTGG - Intronic
1126017563 15:44367123-44367145 ATTTGTTTATATATTGCCTATGG + Intronic
1126133906 15:45372169-45372191 ATTTGTTTACGTATTGTCTATGG + Intronic
1126147512 15:45489919-45489941 ATTTGTTTACATGCTAAGTGTGG + Intronic
1126179060 15:45767202-45767224 ATTTGCTTGTATACTGTCTGTGG + Intergenic
1126456104 15:48863937-48863959 ATATGTTTACATACTCCCTAGGG + Intronic
1126581373 15:50245253-50245275 ATTTGTTTACATATTGTCTACGG + Intronic
1126967247 15:54068473-54068495 ATTTGTTTACATATTGTCTATGG + Intronic
1126987444 15:54328925-54328947 ATTAGTTTACATATTGTCTATGG + Intronic
1127190759 15:56528277-56528299 ATTTGTTTACATATTATCTTTGG + Intergenic
1127213313 15:56798304-56798326 ATTTGTTTACATATTGTCTATGG - Intronic
1127342343 15:58060708-58060730 ATTCAATTATATACTGTCTGCGG - Intronic
1127402775 15:58606946-58606968 ATTTGTTTACACATTGTCTTTGG - Intronic
1127445436 15:59057893-59057915 ATTTATATTCATACTGTCAGTGG + Intronic
1127658081 15:61074501-61074523 ATTTGTAGATATACTGCCTGTGG - Intronic
1127659503 15:61086817-61086839 ATTTGTTTACGTATTATCTATGG + Intronic
1127661992 15:61108483-61108505 ATTTGTTGACATATTATCTATGG + Intronic
1127711964 15:61607860-61607882 ATTTGTTTACTTATTGTCTATGG - Intergenic
1127733677 15:61822268-61822290 ACTAGTTTATATATTGTCTGTGG - Intergenic
1127737623 15:61858983-61859005 ACTTGTTTACAAACCTTCTGTGG + Intronic
1127968313 15:63940246-63940268 ATTTGTATACATATTTTGTGTGG - Intronic
1128050546 15:64660471-64660493 ATTTGTTTACATATTGTCTGGGG + Intronic
1128105330 15:65040177-65040199 ATTTGTTTACATATTGTCTAGGG - Intergenic
1128134726 15:65254439-65254461 GTTTGTTTCCAAACTGTCTGGGG - Intronic
1128404374 15:67320248-67320270 TTTTGTTTAAATACTGGCTGGGG - Intronic
1128541505 15:68537771-68537793 CCTTGTTTACATATTGTCTATGG + Intergenic
1128695423 15:69758464-69758486 ATTTGTTTATATATTGTTTATGG - Intergenic
1128925760 15:71654102-71654124 ATTTGTTTAGTTATTGTCTATGG - Intronic
1128951794 15:71892552-71892574 ATTTGTTTACTTAGTGTCTATGG + Intronic
1128973514 15:72130422-72130444 ATTTGTTCACATACTGTTTATGG - Intronic
1129133882 15:73528714-73528736 ATTTGTTTATGTATTGTTTGTGG + Intronic
1129173703 15:73823962-73823984 GTGTGTTTACTTATTGTCTGTGG + Intergenic
1129345564 15:74916106-74916128 ATTCATTTACATATTATCTGTGG - Intergenic
1129585936 15:76864776-76864798 GTTTGTTTACATACTGACTATGG - Intronic
1129630670 15:77256691-77256713 ATTTGTTTATATATTGTCTATGG + Intronic
1129957616 15:79653911-79653933 TTTTCTTTACATCTTGTCTGTGG - Intergenic
1130006690 15:80106390-80106412 ATTCATTTACTTATTGTCTGTGG + Intronic
1130222363 15:82030471-82030493 ACTTGTGTACAGACTGCCTGTGG + Intergenic
1130298132 15:82661587-82661609 GTTCATTTACATACTGTCTGTGG + Intronic
1130686850 15:86045555-86045577 ATTCATTTACATATTGTCTATGG - Intergenic
1130730332 15:86485521-86485543 ATTTTTTTAGTTATTGTCTGTGG - Intronic
1130812848 15:87399669-87399691 ATTTATTTACATATTATCTATGG + Intergenic
1130873045 15:87986895-87986917 ATTTGTTTATGTGTTGTCTGTGG - Intronic
1130927254 15:88394962-88394984 ATTTGTTTACATGTGGTCTATGG - Intergenic
1131521723 15:93121323-93121345 ATTTGTTTACATATTGGTTGAGG + Intergenic
1131663041 15:94539050-94539072 ATGTGTTTACATACTGTGAAAGG + Intergenic
1132133161 15:99304135-99304157 ATTCGTTTACATATTGTCTCTGG + Intronic
1132169439 15:99633870-99633892 ATTCATTTACATATTGTCTATGG + Intronic
1132280933 15:100614532-100614554 ATTAGTTTACATACTATCTGTGG - Intronic
1133155416 16:3871542-3871564 ATTTGATTACAAACTGAATGAGG - Intronic
1133302341 16:4790303-4790325 ATCTGTTTACCTATTGTCTGTGG - Intronic
1133441702 16:5826529-5826551 ATTTGTTTACATGTTATCTGTGG - Intergenic
1133527174 16:6616915-6616937 ATTTGTTTACATATTGTCTCTGG + Intronic
1133571122 16:7041270-7041292 ATTTGTTTACACGTTGTCAGTGG + Intronic
1133630659 16:7617272-7617294 ATTTATTTACACATTGTCTATGG - Intronic
1133676800 16:8081031-8081053 ATTTATTTACCTATTGTCTGTGG + Intergenic
1133698117 16:8284252-8284274 TTTTTTTTACCTATTGTCTGTGG + Intergenic
1134147807 16:11781224-11781246 ATTTGTTTATGTATTATCTGTGG - Intronic
1134285571 16:12859079-12859101 ACTCATTTACATATTGTCTGTGG + Intergenic
1134465798 16:14476521-14476543 ATTCATTTACATATTGCCTGTGG - Intronic
1134529250 16:14969990-14970012 ACTTGTTTACATACTGTCTGTGG + Intergenic
1134630846 16:15755038-15755060 ATTTGTATGCATAATGTCTATGG - Intronic
1134633596 16:15775487-15775509 ATTGGTTTATATATTGCCTGTGG + Intronic
1134756155 16:16669432-16669454 ACTTGTTTACTTACTGTCCATGG - Intergenic
1134804044 16:17109654-17109676 ATTTATTTGCATATTGTCTGTGG + Intronic
1134812386 16:17178662-17178684 ATTCATTTACATACTGTCTATGG + Intronic
1134840367 16:17396984-17397006 ATTTGTTTACATGTTATCTCTGG + Intronic
1134911123 16:18027405-18027427 ACTTGTTTACCTACTGTCCATGG - Intergenic
1134989913 16:18689732-18689754 ACTTGTTTACTTACTGTCCATGG + Intergenic
1135150039 16:19997510-19997532 ATTTGTTTACATATTGTTTGTGG + Intergenic
1135261026 16:20980940-20980962 ATTAGTTTACACACCATCTGTGG - Intronic
1135462873 16:22660218-22660240 ATTTGTTTACCTACTGCCTATGG - Intergenic
1135464258 16:22671710-22671732 ATTTGTTTACATATTACTTGTGG + Intergenic
1135735709 16:24930583-24930605 ATTTGTTAACATATTGTCTGTGG - Intronic
1135815240 16:25626690-25626712 ATTTGTTTACTTGTTGTCTATGG - Intergenic
1135966856 16:27042692-27042714 AATTGTCTACCTATTGTCTGTGG - Intergenic
1137518885 16:49174758-49174780 ATTTGTTTACATACTGTCTATGG - Intergenic
1137979791 16:53059916-53059938 ATTTGTTTACATACCATCTACGG - Intronic
1138165213 16:54795047-54795069 ATTTATTTACATATTGCCTATGG - Intergenic
1138315129 16:56063269-56063291 ATTCATTTACATATTATCTGTGG + Intergenic
1138561666 16:57804386-57804408 ATTTGTGAACAAACTTTCTGAGG - Intronic
1138918855 16:61502111-61502133 CTTTGGTGACATACTGACTGGGG + Intergenic
1138923818 16:61566513-61566535 ATTCTTTTACATATTGTCTGTGG + Intergenic
1139153995 16:64419034-64419056 TTTTCTTTACATAGTGTCTGTGG + Intergenic
1139232574 16:65298673-65298695 TTTTGTTTGCATAATTTCTGAGG - Intergenic
1139452293 16:67039826-67039848 AATTGTTTACATATTGTCTAGGG - Intronic
1139837694 16:69852841-69852863 ATTTATTTTCATATTGTCTGTGG + Intronic
1139867109 16:70070992-70071014 ACTTGTTTACATACCATCTATGG - Intergenic
1140001451 16:71029227-71029249 ATTTCTTAACATATTGTCTATGG - Intronic
1140166041 16:72552941-72552963 ATTTGTTTATATATTGTCTATGG - Intergenic
1140200498 16:72890816-72890838 ATTGATTTACATACTGTCTATGG + Intronic
1140249455 16:73283139-73283161 ATTAGTTTACCTATTGTCTGTGG - Intergenic
1140254439 16:73322965-73322987 CATTGTTTACATATTGTCTATGG + Intergenic
1140310514 16:73843842-73843864 CTTTGTTTACAAACTGTCTGTGG - Intergenic
1140670329 16:77271290-77271312 ATCTATTTAGATATTGTCTGTGG - Intronic
1140880161 16:79190763-79190785 ATTTGTTTACCTATTGTCTATGG + Intronic
1141002167 16:80318362-80318384 ATTTGTCTGCATATTGTCTATGG + Intergenic
1141044714 16:80705753-80705775 ATTTGTTTATGTATTGTCTGTGG - Intronic
1141314204 16:82945260-82945282 ATTTGTTTCCATATTGTCTGTGG - Intronic
1142789517 17:2253020-2253042 ATTTGTTTACATATTGTCAGTGG + Intronic
1143293228 17:5849342-5849364 ATTTGTTCATATATTGTCTGGGG - Intronic
1143753993 17:9053139-9053161 ATTTGTTTATGTATTGTCTGTGG + Intronic
1143823046 17:9580206-9580228 ATTTGTTTATGTATTGTCTATGG + Intronic
1143878375 17:10010907-10010929 TTTTGTTTACATATTGTCTATGG - Intronic
1144135610 17:12292021-12292043 ATTTGTTTACCTATTGTCCATGG + Intergenic
1144177935 17:12726307-12726329 ATTTGTTTACTTACTGCCCATGG - Intronic
1144267819 17:13588155-13588177 ATTCATTTACATATCGTCTGTGG + Intronic
1144308108 17:13987546-13987568 ATTTGTTTACTTACGGGCTAGGG - Intergenic
1144379526 17:14680574-14680596 ATTCATCTACATATTGTCTGTGG - Intergenic
1145089298 17:19973315-19973337 ATTTGTTTACATATTGTCTATGG + Intronic
1145782027 17:27569706-27569728 ATTTGTGTACGTGTTGTCTGTGG + Intronic
1146264415 17:31442497-31442519 ATTTGTTCACATCTTATCTGTGG + Intronic
1146478981 17:33187648-33187670 ATTCTTTCACATATTGTCTGTGG - Intronic
1146516034 17:33490130-33490152 ATTCATTTACATACTATCTATGG + Intronic
1146698755 17:34934446-34934468 ATTTGTCTATATATTGTCTGTGG - Intronic
1146995532 17:37317287-37317309 ATTTTTTTAAATACTTTTTGAGG + Intronic
1147468274 17:40630380-40630402 GTTTGTTTACATACTGTCTGTGG - Intronic
1147470282 17:40652127-40652149 ATTTATTTACGTATTGTCTTTGG + Intergenic
1147615953 17:41827828-41827850 ATTTGTTTACATGATGCCTATGG + Intronic
1147941717 17:44053263-44053285 ATTTGTTTACACATTGTCTAGGG + Intronic
1148176286 17:45568497-45568519 ATTCATTTACATATTGTCTATGG + Intergenic
1148176753 17:45572712-45572734 ATTTGTTTACTTATTGTCTATGG + Intergenic
1148188918 17:45665308-45665330 ATTCATTTACATGCTGTCTGTGG - Intergenic
1148247884 17:46047370-46047392 ATTTGTTCACATATTGTCTATGG + Intronic
1148294624 17:46490235-46490257 ATTTGTTTACTTATTGTCTATGG - Intergenic
1148348975 17:46925220-46925242 ATTAGTTTACATATTGTCTATGG - Intronic
1148409606 17:47453494-47453516 TTTGATTTACATACTGTCTCAGG - Intergenic
1149148360 17:53527901-53527923 ATTTGTCTGCATATTGCCTGTGG - Intergenic
1149374433 17:56030181-56030203 ATTTGTTTACATATCGTGTATGG + Intergenic
1149434751 17:56623885-56623907 ATTTGTTTGCAAATTGTCTATGG - Intergenic
1149455868 17:56787833-56787855 GTCTGTTTACTTACTGTCTTTGG + Intergenic
1149497231 17:57126857-57126879 ATTTGTTTACGTATTGCCTGTGG + Intergenic
1149534021 17:57418127-57418149 ATTCATTTACATATTGTCTATGG - Intronic
1149573418 17:57694053-57694075 ATTCATTTACATATTGTCTATGG + Intergenic
1149618080 17:58018629-58018651 ACTTGTTTACATATTGTCTATGG + Intergenic
1149628181 17:58095259-58095281 ATTTGTTTACATATTATCTATGG - Exonic
1149679212 17:58493328-58493350 ATTCATTTACTTACTGTCTATGG + Intronic
1149718159 17:58814776-58814798 ATTTGTTTACATATTGCCTATGG - Intronic
1149777224 17:59367477-59367499 ATTTGTTTATATATTCTCTGTGG - Intronic
1149854573 17:60069311-60069333 ATTCATTTACATAGTGTCTATGG + Intronic
1150056880 17:62025234-62025256 ATTTATTTACATATTGTCTGTGG - Intronic
1150164182 17:62925673-62925695 AGTAATTTACATACTGTCTATGG + Intergenic
1150412647 17:64959589-64959611 ATTCATTTATATATTGTCTGTGG - Intergenic
1150468764 17:65417869-65417891 ATTTGTTTACATATTATCCATGG + Intergenic
1150508943 17:65728058-65728080 ATCTGTTGACATACTGTCTATGG + Intronic
1150605601 17:66688033-66688055 ATCTGTTTACATATTGCCTATGG - Intronic
1150713897 17:67555335-67555357 ATTTGTTTACATACTATCTAAGG - Intronic
1150748624 17:67838159-67838181 ATTTGTTTACTTATTGTCTATGG - Intronic
1150799239 17:68265873-68265895 ATTCATTTATATATTGTCTGTGG + Intronic
1150810085 17:68349337-68349359 ATTTGTGTACATATTGTCTGTGG + Intronic
1150841949 17:68616490-68616512 ATTAGTTTAAATACTCTCTATGG - Intergenic
1150849402 17:68690161-68690183 AATTGTTTACACATTGTCTGCGG - Intergenic
1151023974 17:70655788-70655810 ATTCATTTACATATTGTCTATGG - Intergenic
1151063579 17:71124914-71124936 ATTTGTTAACATATTATCTGTGG + Intergenic
1151097669 17:71517869-71517891 ATTTATTTACATATTGTCTATGG - Intergenic
1151169025 17:72230812-72230834 TTTTTTTTACATATTATCTGTGG + Intergenic
1151180963 17:72328190-72328212 ATTTGTTTCCATATTATCTATGG - Intergenic
1151203168 17:72483855-72483877 ATTCATTTGCATACTCTCTGTGG - Intergenic
1151229423 17:72672946-72672968 ATTTGTTTACATATTATCTGTGG + Intronic
1151237096 17:72728593-72728615 ATTTGTTTACATATTGTCTTTGG - Intronic
1151334316 17:73431090-73431112 ATTGGATGACATACCGTCTGTGG + Intronic
1151401971 17:73861677-73861699 ATTCATTTACATATTGTTTGTGG - Intergenic
1151561959 17:74874827-74874849 ACTTCTTTACATATTGTCTATGG + Intergenic
1152051446 17:77981771-77981793 GTTAGTTTACATATTGTCTATGG + Intergenic
1152507509 17:80760242-80760264 ATTTGTTTATATATTGCCTGTGG - Intronic
1152607337 17:81299074-81299096 ACTTGTTTACATATTGTCTCTGG - Intergenic
1152977572 18:237626-237648 ATTTGTAAACATACTAACTGTGG - Intronic
1153435047 18:5059789-5059811 ATTCATTTACGTATTGTCTGTGG - Intergenic
1153546139 18:6207161-6207183 ATTTGTTTATATATTGTCTCTGG + Intronic
1153594273 18:6708615-6708637 ATTTGTTTACATATTATCTATGG - Intergenic
1153681141 18:7502078-7502100 ATTTTCTTATATGCTGTCTGAGG + Intergenic
1153708910 18:7777424-7777446 ATTTGTTTAAATGGTGTCAGTGG + Intronic
1153757584 18:8299773-8299795 ATCTGTTTCTGTACTGTCTGTGG - Intronic
1153884864 18:9455513-9455535 ATTTGCTTACATACGGTCTATGG + Intergenic
1154072506 18:11165353-11165375 ATTTGTTGACATGTTGTCTGTGG + Intergenic
1154084365 18:11288254-11288276 ATTTATTTAAATTATGTCTGTGG - Intergenic
1155013579 18:21808354-21808376 ATTCATTTATTTACTGTCTGTGG + Intronic
1155357407 18:24966636-24966658 ATATATTTATATACTGTCTATGG - Intergenic
1155483708 18:26317529-26317551 ATTTGTTTACACATTGTCTATGG - Intronic
1155694106 18:28663284-28663306 ATTTTTTTTCAAACTCTCTGAGG + Intergenic
1155912575 18:31521510-31521532 ATTTGTTTACATATTGTCTATGG - Intronic
1155945184 18:31840647-31840669 ATTTGTCAACATACTGTCTATGG + Intronic
1156214580 18:34982975-34982997 GTTTGTTTACATCTTGTCTATGG + Intronic
1156419485 18:36935164-36935186 ATTTGATAACATACAGTCTCTGG + Intronic
1156544669 18:37952204-37952226 ATTTGTTTACATATTGTGTATGG - Intergenic
1156810913 18:41250426-41250448 GGTTGTTTACATATTGTGTGTGG + Intergenic
1156877125 18:42028067-42028089 ATTTGTTTTTATATTGTCTATGG + Intronic
1157898644 18:51492250-51492272 ATTCATTTACATATTGTCTATGG - Intergenic
1157972737 18:52288810-52288832 GTTTGTTTACATATTGTCTGTGG + Intergenic
1157973103 18:52293604-52293626 ATTTGTTTACATATTGTCTACGG - Intergenic
1158024518 18:52879776-52879798 ATTTGTTTACCTATTGTCTATGG - Intronic
1158102588 18:53846585-53846607 TTTTTTTTAAATACTGTATGAGG - Intergenic
1159018277 18:63120619-63120641 AATTGTTCCCAAACTGTCTGTGG + Intergenic
1159078378 18:63707250-63707272 ATTTTTTAACATGCTGTCTGGGG + Intronic
1159134612 18:64322312-64322334 ATTTGGTTGCATATTGTTTGGGG + Intergenic
1159344055 18:67175857-67175879 ATTCCTTTACATAGTGTCTACGG - Intergenic
1159525378 18:69582173-69582195 ATTTCTTTACATGTTGTCTGTGG - Intronic
1159642476 18:70879604-70879626 ATATGTTTTCATATTGTCTATGG - Intergenic
1161033163 19:2069115-2069137 TATTATTTACATATTGTCTGTGG - Intergenic
1161348813 19:3781145-3781167 ATATGTTTACATATTGTCTGTGG + Intronic
1162235330 19:9304569-9304591 ATGTGTTTATGTACTGTCTATGG + Intronic
1162256042 19:9490622-9490644 ATTTGTTTATATATTTTCTGAGG - Intronic
1163006244 19:14398273-14398295 GTTTGTGCACATACTGTATGTGG - Intronic
1163066196 19:14797683-14797705 ACTTGTGTACATATTATCTGTGG - Intronic
1163084542 19:14969822-14969844 ATTTGTTCTCATATTGTCTATGG + Intronic
1163140035 19:15341402-15341424 ATATGTTTACATATTATCTATGG - Intergenic
1163257209 19:16163838-16163860 ATTTGTGTACATTTTGTCTATGG - Intronic
1163363527 19:16863059-16863081 ATTCCTTTACATATTGCCTGTGG + Intronic
1163545729 19:17940426-17940448 ATTTGCTAACCTACTGTCAGTGG - Intronic
1164701997 19:30291968-30291990 ATTTGTTTATATGTTGTCTGTGG + Intronic
1164811175 19:31157392-31157414 ATTTATTCACATATTGTCTGTGG + Intergenic
1165564147 19:36709283-36709305 ATTTATTTACATATTATCTATGG + Intronic
1166127839 19:40726509-40726531 ATATGTTTACATAGTGTCTATGG - Intronic
1166154241 19:40898888-40898910 ATTCATTTACATATTGTCTATGG - Intergenic
1166625466 19:44349110-44349132 ATTTGTTTACGTACGGCCTATGG + Intronic
1166627845 19:44376556-44376578 ATTTGTTTACATATTGTCTATGG - Intronic
1166639157 19:44479874-44479896 ATTTGTTTATATATTTTCTGTGG - Intronic
1166735684 19:45083011-45083033 ATTTGTTTCCATATTGTCTATGG + Intronic
1167146972 19:47687202-47687224 ATTCATTTACATATGGTCTGTGG - Intronic
1167373521 19:49098968-49098990 GTTTGTTTACACATTGTCTTTGG + Intronic
1167791035 19:51681628-51681650 GTTTGTTTACCTACTGACTTAGG - Intergenic
1168459390 19:56540727-56540749 ATTCATTTACATATTGTCTTTGG - Intronic
925623566 2:5819109-5819131 ATTTGTTTATATATTGTCTATGG - Intergenic
926104236 2:10140357-10140379 GTTTGTTTACGTATGGTCTGTGG + Intergenic
926324970 2:11777595-11777617 GTTGGTTTACATACTGGCTGTGG + Intronic
926452473 2:13022612-13022634 ATTTGTTTACATATTGTCTATGG - Intergenic
926626912 2:15098821-15098843 ATTCATTTACATATTGTCTGTGG + Intergenic
926736814 2:16079752-16079774 ATTCATTTACATATTGCCTGTGG - Intergenic
927404585 2:22752733-22752755 ATTTGCTTACATATTATCTGTGG + Intergenic
927640653 2:24843515-24843537 ATTTGTTGATATATTGTCTCTGG + Intronic
927998092 2:27500468-27500490 TTTTGTTTACATATGGTCTAAGG + Intronic
928014288 2:27640461-27640483 ATTAATTTACAAATTGTCTGAGG - Intronic
928071970 2:28226149-28226171 ATTCATTTACATATTATCTGCGG + Intronic
928079631 2:28298634-28298656 ATTTCTTTACTTATTATCTGTGG + Intronic
928095126 2:28399842-28399864 ATTTGTTTACATGTTATCTAGGG + Intronic
928097353 2:28412775-28412797 CTTTGTTACCATACTGTCTCTGG + Exonic
928111570 2:28514572-28514594 ATTTGTTTACATGTTGTCCATGG + Intronic
928136218 2:28689576-28689598 ATTCATTTACATATTGTCTACGG - Intergenic
928241260 2:29588712-29588734 ATTTGCTTACATATTGTCTGTGG - Intronic
928415888 2:31091334-31091356 ATTTGTTTACATATCATCTGTGG + Intronic
928498785 2:31864586-31864608 ATTTGATTACACATTGTCTATGG + Intergenic
928530362 2:32185066-32185088 ATTTGTTTCCATAATTACTGAGG + Intronic
928561103 2:32486348-32486370 ATTCATTTACATATTGTCTATGG - Intronic
928603837 2:32926255-32926277 GTTTGATTACATATTGTCTATGG + Intergenic
928970461 2:37022535-37022557 ATTTCTCTACGTATTGTCTGTGG - Intronic
929088446 2:38191728-38191750 ACTTGTTTACTTATTGTCTATGG - Intergenic
929470794 2:42190776-42190798 ATTTGTTTACATATTGTTTATGG - Intronic
929605810 2:43233391-43233413 ATTTGTTTACAGATTGTCCATGG - Intronic
929612230 2:43279602-43279624 ATTTGTTTACCTACTGTTTGTGG + Intronic
930190067 2:48448902-48448924 ATTCATTTACGTACTGTCTATGG - Intronic
930482334 2:51964729-51964751 ATTTATTTACTTATTGTCTGGGG - Intergenic
930538292 2:52671478-52671500 ATTGGTTTAAGTATTGTCTGTGG - Intergenic
930683148 2:54279286-54279308 ATTTGTTTATGTATTATCTGTGG + Intronic
931108684 2:59086608-59086630 GTTTGTTTACATATTGTCCATGG - Intergenic
931162862 2:59713230-59713252 ATCTGTTTACATATTGTCTGTGG - Intergenic
931527609 2:63173995-63174017 ATTCATTTATATATTGTCTGTGG + Intronic
931529074 2:63191899-63191921 GTTTGTTTACATATTGTCTAAGG + Intronic
931536532 2:63283506-63283528 ATTTGTTTACATATTGCCGATGG + Intronic
931589972 2:63872017-63872039 ATTCGTTTACATATAGTCTACGG - Intronic
931853687 2:66279609-66279631 ATGTGTTTACTTATTGTCTGTGG + Intergenic
931975446 2:67639148-67639170 ATTTGTCTACATATTGTCTGTGG - Intergenic
932012971 2:67996919-67996941 ATTCATTTACATATTGTCTGTGG - Intergenic
932195317 2:69777981-69778003 GTTTGTTTATATTTTGTCTGTGG - Intronic
932680764 2:73823105-73823127 ATTTGTTTATGTATTTTCTGTGG - Intergenic
932806724 2:74790885-74790907 ATTTGTTTACAGACTCTCTATGG - Intergenic
932848160 2:75156070-75156092 ATTTGTTTACATATTGTCTATGG + Intronic
932900603 2:75695215-75695237 ATATGTTTACATATTGTCTATGG + Intronic
932940249 2:76155898-76155920 ATTTATTTCCATACTGTCTATGG + Intergenic
932942854 2:76189711-76189733 ATTTCTTTACATATTGTCTATGG + Intergenic
932958245 2:76381613-76381635 ATTTGTTTATGGAGTGTCTGTGG - Intergenic
932986567 2:76732980-76733002 AATTGCTTACATACTGACTTTGG - Intergenic
933012132 2:77079373-77079395 ACTGATTTACATATTGTCTGTGG + Intronic
933056916 2:77682066-77682088 AATTCTTTACACACTGTCTTAGG + Intergenic
933059512 2:77719770-77719792 ATTTGTTTACCCACTGTCTAAGG - Intergenic
933134504 2:78715897-78715919 ATTTGTTTATATATTGTCTATGG + Intergenic
933150127 2:78904387-78904409 ATTTGCTTACATCTCGTCTGTGG + Intergenic
933246777 2:79984965-79984987 ATTTGTTTACATATTGTCTATGG + Intronic
933259251 2:80113581-80113603 ATTTGTTTACTTATTGTTTATGG + Intronic
933320476 2:80770082-80770104 ATTTATTTGCATATTGTCTAAGG + Intergenic
933396194 2:81734311-81734333 TTTTGTTTACATATTATCTAGGG - Intergenic
933575290 2:84060228-84060250 ATTTGCTTACACACTGTCCGTGG - Intergenic
933634388 2:84691666-84691688 ATTCATTCACTTACTGTCTGTGG - Intronic
933927046 2:87103210-87103232 AATTCTTTACACACTGTCTTAGG + Intergenic
934706807 2:96487087-96487109 ATTTGTGTACAAATTGTGTGTGG + Intergenic
935337523 2:102030929-102030951 GTTTGTTTGCAGACTGTCTTTGG + Intergenic
935438542 2:103064010-103064032 CTCTGCTTACATACTTTCTGAGG + Intergenic
935557674 2:104528191-104528213 ATTCGTTTGCATGCTGTCTACGG - Intergenic
936168089 2:110141497-110141519 ATTAGTTTACAAACTCCCTGAGG + Intronic
936392134 2:112084994-112085016 ATTTGTTTGCATGTTGTCTATGG - Intronic
936406349 2:112208042-112208064 ATTTGTTTACATGTTGTCTATGG - Intergenic
936484174 2:112912566-112912588 TCTTGTTTACATATTGTCTCTGG - Intergenic
936817868 2:116481872-116481894 ATTTATTTGCATATTGTCTTTGG - Intergenic
936893609 2:117401286-117401308 ATTTGTTTACTTATTGTGTATGG + Intergenic
936920064 2:117678869-117678891 ATTTGTTTATGTGTTGTCTGTGG - Intergenic
936937299 2:117850613-117850635 ATTTGTTTTCCTACTGTGTGTGG - Intergenic
936948986 2:117958189-117958211 ATTTGTTTACACATTTTCTGTGG - Intronic
937162802 2:119781760-119781782 ATTCGTTTACATATTGTTTATGG + Intronic
937328174 2:121004721-121004743 ATTTCTTGACAGACTGGCTGTGG - Intergenic
937351306 2:121164529-121164551 ATTCAGTTATATACTGTCTGTGG + Intergenic
937593941 2:123650315-123650337 ATTTGTTTATACACTGTCAATGG + Intergenic
937636336 2:124159392-124159414 ATTCATTTACATATTGTCTATGG - Intronic
937729527 2:125211314-125211336 TTATGTTTACATAATTTCTGGGG - Intergenic
938242130 2:129751248-129751270 ATATGTTTATATACTGTTGGTGG + Intergenic
938512153 2:131961280-131961302 ATTCATTTACAAACTGTCTATGG - Intergenic
938545667 2:132328011-132328033 ATTTGTTTACATATTGTCTATGG + Intergenic
938647157 2:133343672-133343694 ATATGATTACATCCTGTCTATGG - Intronic
938649170 2:133363326-133363348 TTTTTTTTACCTATTGTCTGTGG + Intronic
938672036 2:133595779-133595801 GTTTGTTTACATATTGTTTGTGG - Intergenic
938746600 2:134284353-134284375 ATTTGTTTACTTACTGTCTGTGG + Intronic
938825397 2:134999693-134999715 ATTTGTTTACATATTGTCTATGG + Intronic
939343562 2:140932396-140932418 ATTTGTTGACATATTGTCTAGGG + Intronic
939500856 2:142981943-142981965 ATTTGTTTAAATATTGTCCATGG - Intronic
939771392 2:146324104-146324126 ATTTATTTACATCATGTGTGAGG + Intergenic
939866649 2:147480491-147480513 ATTTGTTCACATATTGTCTATGG - Intergenic
939964099 2:148593534-148593556 ATTTGTTTATGTATTGTCTGTGG - Intergenic
940088127 2:149885052-149885074 ATTTGTTTATATGTTGCCTGTGG - Intergenic
940097213 2:149990898-149990920 ATTTGTTTACATATTATCTGTGG - Intergenic
940368376 2:152874283-152874305 ATTTCTTTACATAGTGTCTATGG - Intergenic
940633049 2:156262699-156262721 ATTCATTTACATATTGTCTATGG + Intergenic
940677732 2:156745795-156745817 ATTCATTTACATATTGTCTATGG - Intergenic
941019462 2:160392347-160392369 ATTTGTTTATATATTATCTATGG + Intronic
941147048 2:161861012-161861034 ATTTGTGTACATGTTGCCTGTGG + Intronic
941185459 2:162317207-162317229 GTTTGTTTACATATTGCTTGTGG - Intronic
941306571 2:163876583-163876605 ATTTGTTTAATAACTGTGTGTGG + Intergenic
941710493 2:168706939-168706961 ATTTGTTTTCTTATTGTCTATGG - Intronic
941970756 2:171348373-171348395 ATTTGTTGACATACTGTCTATGG - Intronic
942131705 2:172886270-172886292 ATTTATTTACATATTATCTATGG + Intronic
942433836 2:175948400-175948422 TTTTGTTTACAGATTGTCTATGG + Intronic
942552717 2:177136116-177136138 ATTCATTTACATATTGTCTATGG + Intergenic
942662155 2:178276983-178277005 ATTTGTTTATATATTGTCTGTGG + Intronic
943626307 2:190204880-190204902 ATCTGTTTATATATTATCTGTGG - Exonic
943652056 2:190467853-190467875 ATTCATTTACATATTGCCTGTGG + Intronic
943671228 2:190663461-190663483 ATTTATTTATGTACTGTTTGTGG + Intronic
943678888 2:190746673-190746695 ATGTGTTCACACACTGTCTCAGG - Intergenic
943760579 2:191603880-191603902 ATTTGTTTACATATTGTCTATGG + Intergenic
943855391 2:192783707-192783729 ATTTGTTTCCATATTGTCTATGG + Intergenic
943886814 2:193228580-193228602 ACTTGCTTACTTAGTGTCTGGGG + Intergenic
944126567 2:196300252-196300274 ATTTGCTTACATGTTGTCTTTGG + Intronic
944220142 2:197295382-197295404 ATTTGTTTACGTCTTGTCTATGG - Intronic
944223860 2:197329900-197329922 ATTTGTTTACATATTGTCAGTGG - Intergenic
944268774 2:197758556-197758578 ATTTGTTTACTTATTGTCTATGG - Intronic
944281481 2:197903258-197903280 ATGCGTTTGCATAGTGTCTGTGG - Intronic
944495366 2:200302441-200302463 ATTTGTTTACATAGTGCCTATGG + Intergenic
944682169 2:202087104-202087126 ATTTGTTTACATATTGCCTATGG + Intronic
944853264 2:203742126-203742148 ATTTGTTTATATATTGTTTATGG - Intergenic
945044722 2:205771863-205771885 ATTTGTTTACATATTGCTTATGG - Intronic
945127627 2:206530234-206530256 ATTTGTTTACATACTGCCCGTGG + Intronic
945379836 2:209127664-209127686 ATTTCTTTACATGTTATCTGTGG - Intergenic
945434686 2:209805423-209805445 ATTTTTTTGCATAGTTTCTGAGG + Intronic
945541035 2:211087081-211087103 ATTTGTTTACTGACTGCCTATGG - Intergenic
945712053 2:213309253-213309275 ATTTGTTTACATATTATGTATGG - Intronic
945722710 2:213438470-213438492 ATTTATTTACATATTGCCTATGG + Intronic
945779830 2:214155411-214155433 ATTTATTTACATATTCTCTAAGG + Intronic
945792732 2:214325581-214325603 ATTTGTTTACAAATTATCTTGGG + Intronic
945830493 2:214778666-214778688 ATTAGTTTGCATATTGCCTGTGG + Intronic
945915760 2:215702340-215702362 ATACGTTTACATATTGTCTATGG - Intergenic
946350698 2:219149858-219149880 ATTTGTTTACATATTGTCTGTGG - Intronic
946594574 2:221292277-221292299 ATTTGTTTAGTTATTGTCTATGG - Intergenic
946652297 2:221906451-221906473 AGTTGTGGACATACTGTCTGTGG - Intergenic
947111889 2:226727395-226727417 ATTCATTTACATATTGCCTGTGG - Intergenic
947129843 2:226910012-226910034 ACTTGTTTACATATTGTCTCTGG - Intronic
947176615 2:227373584-227373606 ATGTATTTACATATTGTCTATGG + Intronic
947408272 2:229804787-229804809 ATTTGTTCACATATTGTATATGG + Intronic
947516994 2:230814679-230814701 ATTTATTTACATATTGTCTGTGG + Intronic
948295575 2:236857761-236857783 ATTTGTTTACGTATTGACTAGGG - Intergenic
948679846 2:239626423-239626445 ATTCATTTGCATACTGTCTGTGG - Intergenic
948917589 2:241043812-241043834 ATTCATTTACATATTGTCTATGG - Intronic
1168778113 20:465277-465299 ATTCATTTACCTACTGTCTATGG + Intergenic
1168781599 20:496283-496305 ATTTGTTTGCATATTGTTTATGG + Intronic
1168998862 20:2152218-2152240 ATTTGTTTACATGGTGTCTATGG - Intronic
1169053619 20:2601263-2601285 ATTTATTTACATCTTGTCTATGG + Intronic
1169100183 20:2940756-2940778 ATTTGTTTATATATTGTCTGTGG + Intronic
1169389946 20:5182010-5182032 ATTTGTTTACATATTGTCTATGG - Intronic
1169417307 20:5428327-5428349 GTCTGTCTCCATACTGTCTGTGG + Intergenic
1169545062 20:6641436-6641458 GTTTGATTAGATGCTGTCTGAGG - Intergenic
1169723582 20:8704673-8704695 AATTGTTTACATATTATCTGTGG + Intronic
1169750094 20:8982931-8982953 ATCTATTTACATATTATCTGTGG - Intergenic
1169837963 20:9901621-9901643 ATTTGTTTGCATATTGACTATGG + Intergenic
1170284411 20:14690762-14690784 ATTTGTTTACATATTGTCTATGG + Intronic
1170536420 20:17345525-17345547 ATTTGTTTATACACTGCCTATGG - Intronic
1170969602 20:21104785-21104807 TTTTGTTTACATATTCTCTCTGG + Intergenic
1171161613 20:22930076-22930098 GTTTGATTACATTCTGTCGGTGG - Intergenic
1171177465 20:23063350-23063372 ATTCGTTTATATATGGTCTGCGG - Intergenic
1171201051 20:23242489-23242511 ATTTGTTTATATATTGCCTATGG - Intergenic
1171341916 20:24436342-24436364 ACTTGTTTATGTATTGTCTGTGG + Intergenic
1171874527 20:30560762-30560784 ATTTGTTTACATATTGTCTATGG + Intergenic
1171949553 20:31408608-31408630 ATTTGCTTATATATTGTCTGTGG - Intronic
1172300989 20:33850108-33850130 CTTAATTTACATATTGTCTGTGG + Intronic
1172816125 20:37688009-37688031 ATTTGTTTCAAAACTGTCAGAGG - Intergenic
1172832394 20:37846916-37846938 ATTTGTTTACTCTCTGTCTCTGG + Intronic
1173019048 20:39252028-39252050 CTTTGCTTAGATACTGTCTAAGG - Intergenic
1173307526 20:41864197-41864219 ATGTGTTTACGTGTTGTCTGTGG - Intergenic
1173358224 20:42315537-42315559 GTTCATTTACATACTGTCTATGG - Intronic
1173525035 20:43725459-43725481 ATTTGTTTACATATTATATGTGG + Intergenic
1173636763 20:44566222-44566244 TTTTGTTTACACATTGTGTGTGG + Intronic
1173670775 20:44797262-44797284 TTTCATTTACATATTGTCTGGGG + Intronic
1173895034 20:46544735-46544757 ATTTGTCAATATATTGTCTGTGG - Intronic
1173929756 20:46808766-46808788 ATTTATTTGTATAATGTCTGTGG + Intergenic
1173946568 20:46955947-46955969 CTTTGCTTACATATTGTCTAGGG - Intronic
1174142129 20:48422779-48422801 ATTCATTTACATATTGACTGTGG + Intergenic
1174207460 20:48851073-48851095 CTTTGTTTACCTATTGTCTGTGG + Intergenic
1174307690 20:49626055-49626077 GTTTGTTTACATATTGTCTGGGG + Intergenic
1174319363 20:49728676-49728698 CTTTGTTTACATAGTGGCTATGG - Intergenic
1174581547 20:51575699-51575721 ATTTATTTACAGATTGTCTATGG + Intergenic
1174643205 20:52063056-52063078 ATTTGTTTGCATATTGTCTATGG + Intronic
1174669906 20:52297496-52297518 ATTTGTTTACATATTGTCTACGG + Intergenic
1174712750 20:52724772-52724794 GCTTGTTTACATAATGTCCGTGG - Intergenic
1174729389 20:52900579-52900601 ATTTCTTTACATATTGTCTGTGG + Intergenic
1174733479 20:52941065-52941087 ATTTGTTTACATATTGTCCATGG - Intergenic
1174745255 20:53055852-53055874 ATTTGTTTACCTCCTGTCCATGG + Intronic
1174756045 20:53159366-53159388 ATTTGTTGACGTATTGTCTGTGG + Intronic
1174770025 20:53290893-53290915 ATTTGTTTACATATTGTCTATGG + Intronic
1174774315 20:53330007-53330029 ATTTGTTTACATGTTATCTATGG + Intronic
1174810008 20:53637516-53637538 ATTGGTTTACTTACTGTCTGTGG + Intergenic
1174868021 20:54156735-54156757 ATTAGTTTACAAATTGCCTGTGG + Intronic
1174877934 20:54247908-54247930 ATTTGTTTACATATGATTTGTGG + Intergenic
1175049496 20:56141330-56141352 ATTTATTTACATATGATCTGTGG + Intergenic
1175496937 20:59421305-59421327 ATTTGTTTACATATCGTATGTGG + Intergenic
1175515416 20:59566986-59567008 ATTTGTTTACATATTATCTGGGG + Intergenic
1175627234 20:60499822-60499844 ATTTGTTGACGTATTGTGTGTGG + Intergenic
1175716208 20:61255320-61255342 ATTTGTGAACAGACCGTCTGTGG - Intronic
1176781610 21:13201496-13201518 ATTCATTTACAAACTGTCTATGG + Intergenic
1177021724 21:15868684-15868706 ATTTGTATACATATTGTCTGTGG + Intronic
1177061047 21:16374510-16374532 ATTTATTTACATAGTGTGGGTGG - Intergenic
1177217380 21:18147718-18147740 ATTTGTTTACATACTGTCTATGG - Intronic
1177608444 21:23413444-23413466 ATTTGTTAACATATTGTTTATGG - Intergenic
1177819487 21:26015895-26015917 ATTTGTTTAAAAATTGTCTATGG - Intronic
1177979314 21:27890631-27890653 ATTCATTTACAAACTGTCTACGG + Intergenic
1178153363 21:29822222-29822244 TTTTGTTTACATATTGTCTATGG - Intronic
1178248726 21:30980245-30980267 ATTCGTTTACATGGTGTCTGAGG + Intergenic
1178391248 21:32200175-32200197 ACTTGTTTACATTATGTCTGTGG - Intergenic
1178910931 21:36672950-36672972 CTTTGTTTACACACTGCCTTTGG + Intergenic
1179227053 21:39463676-39463698 ATTCATTTACCTATTGTCTGTGG + Intronic
1179352738 21:40628509-40628531 ATTTGTTTATGTATTGTCTGTGG + Intronic
1179397736 21:41056871-41056893 ATTAATTTACATATTGTCTATGG - Intergenic
1179589093 21:42393770-42393792 ATTTGTTCACATACTGTCTGTGG - Intronic
1179771614 21:43623159-43623181 ATGTGTTTATATAGTTTCTGAGG - Intronic
1180608668 22:17081466-17081488 CTTTGTTTACATATTGTCAATGG + Intergenic
1181754669 22:25015266-25015288 ATTTATTTACATATTATCTATGG - Intronic
1181890646 22:26060207-26060229 ATTTGTTTACATATGGTCTATGG + Intergenic
1181955001 22:26581913-26581935 ATTTATTGACATTTTGTCTGTGG - Intronic
1182025212 22:27112686-27112708 ATTTCTTTACATATTGTCTATGG + Intergenic
1182117409 22:27764947-27764969 ATTTGTTTACATTTTGTTTATGG + Intronic
1182154610 22:28058194-28058216 ATTTGTTTACATATTGTTTATGG - Intronic
1182270722 22:29151572-29151594 ATTTGTTTACATATTGTCTGTGG - Intronic
1182527644 22:30931292-30931314 ATTCCTTTACATACTGTCTGTGG + Intronic
1182561482 22:31163182-31163204 ATATATTTACATATTGTCTTTGG + Intronic
1182653039 22:31867623-31867645 ATTCATTTACATATTGCCTGTGG + Intronic
1182742543 22:32578904-32578926 ATTTGTGCACATAATGTCTGTGG - Intronic
1182742773 22:32580722-32580744 ATTCATTTACGTATTGTCTGTGG + Intronic
1182910926 22:33983718-33983740 TCTTGTTTACATATTGTCTATGG - Intergenic
1182919504 22:34066410-34066432 ATGTATTTACATATTGTCTGTGG - Intergenic
1183028324 22:35083113-35083135 GTGTGTTTACATATTTTCTGAGG - Intronic
1183215309 22:36475552-36475574 ATTTGTTTGTATAGTGTCTATGG + Intronic
1183229482 22:36572392-36572414 ATTTGTTTACATATTGTTTATGG - Intronic
1183810923 22:40256611-40256633 ATATGTTTACACATTGTCTATGG + Intronic
1184619635 22:45666531-45666553 ATTCATTTACATATTCTCTGTGG - Intergenic
1184818028 22:46886845-46886867 ATCTGTTTATGTACTGTGTGTGG - Intronic
949208466 3:1469219-1469241 AATTGTTTCTATACTGTCTCAGG - Intergenic
949232421 3:1767003-1767025 ATTTGTTAACATATTGTTTGTGG - Intergenic
949387788 3:3523275-3523297 ATTTGTTCACACATTGTCTACGG + Intergenic
949388504 3:3532707-3532729 CTTTGTTTACATATTGTCTGTGG - Intergenic
949449542 3:4170120-4170142 ATTTATTTATATATTGTCTATGG + Intronic
949577271 3:5350862-5350884 ATTCATTTACATATTGTCTAAGG - Intergenic
949614709 3:5740115-5740137 ATTTGTTTATGTACTGTCTATGG - Intergenic
949764449 3:7510840-7510862 ATTTGTTTACATATTTTCTATGG + Intronic
950190937 3:10975670-10975692 ATTTGCTCACATACTGTCTATGG - Intergenic
950460160 3:13116355-13116377 ATTCATTTATATATTGTCTGTGG - Intergenic
950875920 3:16273027-16273049 ATTTGTATACATACTGTCTATGG - Intronic
950909687 3:16576213-16576235 ATTTCTTTCCATTCTGTATGTGG - Intergenic
950986368 3:17373003-17373025 ATTTGTTTACTTATTGTCTGTGG - Intronic
951039190 3:17969417-17969439 AACTGTTTGCATATTGTCTGTGG - Intronic
951090672 3:18569926-18569948 ATTGATTTACATATTGTCTATGG + Intergenic
951142916 3:19188112-19188134 ATTTGTTTGCATATTGTCTATGG + Intronic
951142931 3:19188413-19188435 ATTTGTTTACATATTGTCTATGG - Intronic
951146020 3:19228232-19228254 AATTGTTTACATATTTTCTGTGG + Intronic
951152996 3:19314648-19314670 ATTTGTTTATAGATTGTCTATGG - Intronic
951226338 3:20125512-20125534 ATTCTTTAACATATTGTCTGTGG + Intronic
951357233 3:21682836-21682858 ATTTGTTTACATACTGTCTATGG - Intronic
951366742 3:21792435-21792457 ATTTGTTTGCTTATTGTCTATGG + Intronic
951404094 3:22272720-22272742 AATTATTTACATACAGTCTAAGG - Intronic
951431476 3:22612694-22612716 ATCTGGTTAGATACTATCTGTGG - Intergenic
951476753 3:23114695-23114717 ATTTGTCTACAAATTGTCTGTGG + Intergenic
951587119 3:24226832-24226854 ATTTATTTACATATAGTCTATGG + Intronic
951603595 3:24405337-24405359 GTTTGTTTACAGACTGTCTATGG + Intronic
951618464 3:24574661-24574683 GTTTATTTACATATTGTCTATGG + Intergenic
951682341 3:25307889-25307911 ATTTGTTTACATATTATCTGTGG + Intronic
951941485 3:28084103-28084125 ATTTGCTTACTTATTGTCTACGG - Intergenic
951992431 3:28690272-28690294 ATTTGTTTATATATTGTCTGTGG + Intergenic
952007297 3:28856659-28856681 ATTTGTTTGCATATTGTCTATGG + Intergenic
952198464 3:31100675-31100697 ATTTGTTTACATAATGTCTATGG - Intergenic
952238575 3:31506436-31506458 ATTTGTTAAAAGGCTGTCTGGGG + Intergenic
952240220 3:31524547-31524569 ATTTGTTTATGTATTGTCTATGG + Intergenic
952284909 3:31958824-31958846 ATTTGTTTACATATTGCCTAGGG + Intronic
952308671 3:32168641-32168663 ATTTGTTTATAGACTGTAGGTGG + Exonic
952424103 3:33157513-33157535 ATGTGTGTACTTACTGGCTGTGG + Intronic
952542885 3:34386491-34386513 ATTTGTTTACATATTGTTTATGG - Intergenic
952698637 3:36301840-36301862 ATTTGTTTACATATTGTCTATGG + Intergenic
953395136 3:42563157-42563179 ATTCTTTTACATGTTGTCTGTGG - Intronic
953608988 3:44431861-44431883 ATTCATTTACATATTGTCTGTGG - Intergenic
953744233 3:45560907-45560929 AATTGTTTACATATCATCTGTGG + Intronic
953935807 3:47041234-47041256 ATTTGCTTACAAATTGTCTATGG - Intronic
954593357 3:51803178-51803200 CTTTGTTTACATATAGTCTGTGG + Intergenic
954767737 3:52935376-52935398 ATTTGTTTACATATTGTCTGTGG + Intronic
954975117 3:54686204-54686226 ATTCATTTACATATTGTCTGTGG + Intronic
955037921 3:55286885-55286907 ATTCATTTACACACTGCCTGTGG - Intergenic
955095829 3:55796774-55796796 ATTTGTTTATAAATTGTCTCTGG + Intronic
955112459 3:55962398-55962420 ATTAGTGTATATATTGTCTGTGG - Intronic
955139827 3:56258321-56258343 ATTTGTTCACACATTGTCTCTGG - Intronic
955331997 3:58054882-58054904 ATTTATTTATGTACTGTCTATGG + Intronic
955350112 3:58187356-58187378 ATTTGTTTTTATATTGTCTATGG - Intergenic
955362375 3:58286589-58286611 ATTTGTTTACATATTGCCTATGG - Intronic
955411883 3:58661084-58661106 ATTCATTTATATATTGTCTGTGG - Intronic
955422787 3:58756033-58756055 ATTTGCTTACATTTTGTCTATGG + Intronic
955526020 3:59820589-59820611 GTTTGTTTATATATTGTCTTTGG + Intronic
955636305 3:61033272-61033294 ATTTGTTTACATATTGTCTATGG + Intronic
955696867 3:61645742-61645764 ATTTGCTCACATATTGTCTATGG - Intronic
955699325 3:61667997-61668019 ATTTGTTGACTTATTGTCTATGG + Intronic
955713381 3:61803052-61803074 ATTTGTTTACATATTATCCATGG + Intronic
955802427 3:62699895-62699917 ATTTGTTTACATATTGTCTATGG + Intronic
955830316 3:62994593-62994615 ATTCATTTACATATTGTCTAAGG + Intergenic
955844925 3:63152425-63152447 ACTTGTTTGCACATTGTCTGTGG - Intergenic
955868796 3:63415591-63415613 ATTTGGTTACATATTGTCTATGG - Intronic
956201558 3:66711532-66711554 ATTTGTTTATAAATTGTCTATGG + Intergenic
956205427 3:66750080-66750102 ATTCATTTATATATTGTCTGTGG - Intergenic
956251422 3:67238142-67238164 ATTTGTTTACGTATTATCTGTGG - Intergenic
956263604 3:67372947-67372969 ATTTGTGTGCATGTTGTCTGTGG - Intronic
956330751 3:68104705-68104727 ATTTGTTTACACATTGTTTATGG + Intronic
956331664 3:68116864-68116886 ATTGATTTACTTACTGTCTATGG + Intronic
956408608 3:68954818-68954840 ATTGGCTTACATATTGCCTGTGG - Intergenic
956459818 3:69460690-69460712 ATTTGTTTCCATATTGTCTATGG - Intronic
956608465 3:71097331-71097353 ATTCATTTACATATTGTCTATGG + Intronic
956817144 3:72918099-72918121 ATTTGTTTATATATTGTTTGTGG - Intronic
956833788 3:73079204-73079226 ATTTCTTTATGTATTGTCTGTGG + Intergenic
956903921 3:73745771-73745793 ATTTGTTTACGCATTGTCTCTGG + Intergenic
957515823 3:81249757-81249779 ATTTGTTTACATATGATCTGTGG - Intergenic
957516828 3:81265539-81265561 CTTTGTTTACATATTTTCTATGG + Intergenic
957973546 3:87413900-87413922 AATAGTCTACATACAGTCTGAGG + Intergenic
958079613 3:88729424-88729446 ATTTATGTACATATTGTCTATGG + Intergenic
958447054 3:94228593-94228615 CTTTGTTTACATACTGTTTGAGG + Intergenic
958739764 3:98055353-98055375 ATTTTTTTTCATAGTTTCTGAGG + Intergenic
958924206 3:100139867-100139889 ATTTGTTTATACACTGCCTAGGG + Intronic
958954610 3:100453632-100453654 TTTTGTTTTCATATTGTCTCAGG + Intronic
959396058 3:105839674-105839696 ATTTATTTACTTACTGTCTGTGG - Intronic
959431858 3:106264079-106264101 ATTTGTTTTCATACAGACTTTGG + Intergenic
959866819 3:111280388-111280410 ATTTCTTTACATATTGTCTATGG - Intergenic
960030668 3:113051508-113051530 ATTTGTCTCCATTCTGTCTGAGG - Intergenic
960135903 3:114104426-114104448 ATTCTTTTACATATTGTCTATGG + Intergenic
960263660 3:115596037-115596059 ATTTGTTTACATCTTATCTATGG + Intergenic
960460608 3:117930215-117930237 ATTCATTTACATATTGTCTTTGG + Intergenic
960739650 3:120819076-120819098 ATTCATTTACATCTTGTCTGTGG - Intergenic
961435596 3:126914345-126914367 ATTAGTTCACATATTGTCTGTGG - Intronic
961638138 3:128346773-128346795 ATTTGTTTACATATTGTCTATGG - Intronic
961796057 3:129409718-129409740 ATTTGTTAAGGTGCTGTCTGTGG + Intronic
961857889 3:129891456-129891478 ATTTGTTCACGTACTGTCTGTGG + Intronic
961914576 3:130359724-130359746 GTTTGTTTACATATTTTCTGTGG + Intronic
962463539 3:135636348-135636370 CTTTGTTTCCATATTGTCTATGG + Intergenic
962762771 3:138531476-138531498 ATTCATTTACATATTATCTGTGG + Intronic
963024011 3:140900566-140900588 GTTGGTTTACATATTGTCTATGG + Intergenic
963069813 3:141293754-141293776 ATTCCTTTATGTACTGTCTGTGG - Exonic
963214681 3:142731938-142731960 ATTTGTTTACATATGGTCTGTGG + Intronic
963254410 3:143130551-143130573 ATGTCTTTACAGAATGTCTGGGG + Intergenic
963291178 3:143491418-143491440 ATTTGTTTACTTACTGTCTACGG - Intronic
963352507 3:144169198-144169220 ATTTGTTTACAAGTTGTCTATGG + Intergenic
963500193 3:146115861-146115883 ATTTGTTTACATATTGTCTGTGG - Intronic
963859816 3:150297591-150297613 ATTTGCTTACTTATTGTCTGTGG - Intergenic
963975699 3:151477867-151477889 ACTTGTTTACATATTATCTATGG - Intergenic
964056071 3:152459742-152459764 ATTTGTTTACATGTGGTCTCTGG - Intronic
964117696 3:153153832-153153854 ATCTATTTACATATTTTCTGTGG + Intergenic
964410194 3:156389888-156389910 ATTAATTTACATATTGTCTATGG + Intronic
964600507 3:158495779-158495801 ATTTGTTTACATATTGTCAATGG + Intronic
964773323 3:160247946-160247968 ATTTGTTTCCATAATGGCTATGG + Intronic
964836533 3:160945305-160945327 ATTTGTTTATATATTGCCTATGG - Intronic
964896793 3:161607309-161607331 ATTTGTTTATGTATTGTCTATGG + Intergenic
965120871 3:164554572-164554594 ATCCATTTAAATACTGTCTGTGG - Intergenic
965740674 3:171870963-171870985 ACTTGTTTATATATTGTCTATGG + Intronic
965775152 3:172221910-172221932 ATCTGTTTACCTACTAGCTGTGG + Intronic
966129046 3:176615650-176615672 ATTTGTTTACACATTATCTATGG + Intergenic
966161262 3:176971004-176971026 ACTTGTTTCCATACTGTCTGTGG + Intergenic
966235147 3:177692468-177692490 ATTTGTGTACATATTGTCTATGG - Intergenic
966294287 3:178400969-178400991 ATTTGTATAAATAATGGCTGAGG - Intergenic
966300388 3:178472666-178472688 ATTCGTTTACATATTATCTATGG + Intronic
966303811 3:178508626-178508648 TTTTGTTTACATATCGTCTGTGG - Intronic
966448063 3:180025778-180025800 GTTTCTTAACATACTATCTGTGG - Intronic
966510413 3:180756262-180756284 ATTTATTTACACACTGTCAGAGG - Intronic
966580582 3:181557944-181557966 ATTGGTTTCCATATTGTCTGTGG - Intergenic
966706057 3:182915241-182915263 TTATGTTAACATAATGTCTGTGG + Intronic
966792777 3:183689004-183689026 ATTTGTGTACAAACTTTGTGTGG + Intergenic
966987977 3:185199703-185199725 ATTTGTTTCCATATTGTCTATGG + Intronic
967106150 3:186256381-186256403 ATTTGCTGACAGACTGTATGTGG - Intronic
967268101 3:187709394-187709416 ATTTATTAAAATACTGTCTCTGG + Intronic
967549191 3:190769951-190769973 ATTTATTTACTTATTGTCTATGG + Intergenic
967766764 3:193289483-193289505 ACTTGTTTACCTATTGTCTAAGG + Intronic
967875139 3:194263666-194263688 ATTCATTTACATATTGTCTATGG + Intergenic
968024056 3:195423723-195423745 ATTTATTTACATATTGTTTATGG - Intronic
969064060 4:4463255-4463277 ATTTGTTTACATATTGTCTAGGG - Intronic
970063644 4:12065821-12065843 ATTTATTTACATACTTATTGAGG - Intergenic
970072895 4:12182522-12182544 ATTTGTCTACATGCTGTCTATGG - Intergenic
970204777 4:13644956-13644978 ACTTGTTTACATATTGTCCATGG + Intergenic
970270213 4:14338624-14338646 ATTTGTTTACATATTGTCTATGG + Intergenic
970279020 4:14433690-14433712 ATTTGTTTATGTATTGTCTATGG - Intergenic
970434791 4:16023020-16023042 ATTTGTTTAGATATCATCTGTGG - Intronic
970700352 4:18729758-18729780 ATTTATTTACCTATAGTCTGTGG + Intergenic
970837245 4:20424730-20424752 ATTTGTTAACATTCTGTGAGAGG + Intronic
970964747 4:21915173-21915195 ATTTGTTTATGTGTTGTCTGTGG - Intronic
971015185 4:22481561-22481583 ATTTGTTTACATATTGTTGATGG + Intronic
971175085 4:24274486-24274508 ATTTGTTTACATACTGTCTATGG - Intergenic
971821921 4:31568240-31568262 ATTTGTTTAAGTATTGTCTATGG - Intergenic
972587777 4:40454091-40454113 ATTCGTTTACATATAGTCTGTGG + Intronic
972704014 4:41523357-41523379 ATTCATTTACATATTGTCTATGG - Intronic
972754163 4:42027292-42027314 TTTTATTTACATATTGTCTGTGG + Intronic
972777164 4:42252165-42252187 ATTTGTTTAAGTATTGTCTACGG - Intergenic
972780679 4:42284515-42284537 ATTTGTTTACATACTAAGTTAGG - Intergenic
973325504 4:48856748-48856770 AGTTGTTTTCATAGAGTCTGTGG + Intronic
973827051 4:54718531-54718553 ATTTGATTATATAATGTCTATGG + Intronic
973965295 4:56155714-56155736 ATTTGTGTGCATGCTTTCTGAGG + Intergenic
974071138 4:57125316-57125338 ATTTGTTTACATATCGTCTATGG - Intergenic
974162614 4:58159181-58159203 ATTTGTTTACTTAATGTTAGTGG + Intergenic
974256604 4:59464402-59464424 ATTTATTTATATATTGTCTCTGG + Intergenic
974278952 4:59764859-59764881 ATTTATATACCTACTTTCTGTGG - Intergenic
974373774 4:61050106-61050128 ATGAGTTAACATACTGTCAGGGG - Intergenic
974436041 4:61858281-61858303 ATTTGTTTATATATTATCTATGG - Intronic
974616523 4:64290830-64290852 ATTTGTTTACATTATGTCCTGGG - Intronic
974833481 4:67217030-67217052 ATTTGTTTATACATTGTCTATGG + Intergenic
974862655 4:67542249-67542271 CTTTGTTTACATACTGTCTGTGG - Intronic
975816297 4:78220393-78220415 ATTTATTTACATACTGTCTGTGG + Intronic
975820196 4:78262946-78262968 ATTCATTTACATATTGTCTATGG - Intronic
975921830 4:79399919-79399941 AATTGTTTACAGATTCTCTGGGG - Intergenic
975943236 4:79673558-79673580 ATTTATGTGCATATTGTCTGTGG - Intergenic
975957164 4:79855312-79855334 ATTTGTTTACATATTTTCTATGG - Intergenic
976085361 4:81402382-81402404 ATTTATTTACATTCTCTCTCAGG - Intergenic
976186490 4:82447630-82447652 ATTTATTTAAATAATGTCTGTGG - Intronic
976686952 4:87824512-87824534 ATTTGTTTACGAATTGTCTATGG - Intronic
976789810 4:88865725-88865747 ATTTGTTTATATATTGTCTGTGG - Intronic
976954956 4:90884425-90884447 ATTTATATACATATTGTCTGTGG + Intronic
977170915 4:93761444-93761466 ACTTGTTTACTTACTTTCTACGG + Intronic
977534361 4:98239941-98239963 ACTTGTTTATATATTGTCTAAGG + Intergenic
977925284 4:102693665-102693687 ATTTGTTTACTTATTGTCTTTGG + Intronic
978330149 4:107603596-107603618 ATTTGTTTATGTATTATCTGTGG - Intronic
978360283 4:107924405-107924427 ATTTATTTACTTATTGTCAGTGG + Intergenic
978362015 4:107940413-107940435 ATTTGTTTACATACGTTCTATGG - Intronic
978473669 4:109100504-109100526 ATTCATTTTCATGCTGTCTGTGG + Intronic
978701990 4:111658668-111658690 ACTTGATTACTTCCTGTCTGTGG + Intergenic
978725418 4:111963874-111963896 ATTTGTTTATGTACTGTCTATGG + Intergenic
978750259 4:112238027-112238049 ATTTGTTGAAATGCTGTCTATGG - Intronic
978814182 4:112884384-112884406 ATTTGTTTGCATATTGTCTATGG - Intronic
979067202 4:116152698-116152720 ATTCCTTTACATATTGTCTATGG + Intergenic
979357528 4:119722698-119722720 AATTATTTACGTATTGTCTGTGG + Intergenic
979357762 4:119725649-119725671 ATTTATTTATATATTGTCTGTGG + Intergenic
979625568 4:122841226-122841248 CTTTGTTTAAACATTGTCTGTGG + Intronic
979671296 4:123362885-123362907 ATTTGTATGCATTCTGTGTGGGG + Intergenic
979863324 4:125722206-125722228 ATTCATTTACACATTGTCTGTGG - Intergenic
980400205 4:132273866-132273888 AATTGTTTGTATACTGCCTGTGG + Intergenic
980636742 4:135515591-135515613 TTTTGTTTTCACACTGTCTTGGG - Intergenic
980895794 4:138858641-138858663 ATTAGTTTACATATTGTCTAGGG + Intergenic
981101766 4:140836864-140836886 ATTTGTTTACATATTATCTATGG - Intergenic
981295673 4:143127915-143127937 ATTTGTTTACTTATTGTCTATGG + Intergenic
981432941 4:144683718-144683740 ATTTGTTTATGTATTCTCTGTGG + Intronic
981589010 4:146336189-146336211 ATTTGTTTACCTATTGTCTTTGG - Intronic
981746374 4:148056048-148056070 AGTTGTTTACGTTTTGTCTGTGG + Intronic
981811374 4:148779743-148779765 ATTTATTTACTTATTGTCTATGG - Intergenic
981988744 4:150889870-150889892 ATTATTTTAAATATTGTCTGTGG - Intronic
982145041 4:152378026-152378048 ATTTGTTTAAGTACTGTCTGTGG + Intronic
982187261 4:152815238-152815260 ATTCATTTGCATACTGTCAGTGG + Intronic
982530000 4:156528447-156528469 ATTTGTTTATAAACTGTCTATGG - Intergenic
982640847 4:157958254-157958276 ATTTATTTACATAATGTCTATGG + Intergenic
982673261 4:158347580-158347602 ATTTGTTTATGTCTTGTCTGTGG + Intronic
982823657 4:159975965-159975987 TTTGGTTTAAATACTGTCAGGGG - Intergenic
982915124 4:161198378-161198400 TTTTGTTTACTTACTGTAAGAGG - Intergenic
983179307 4:164629555-164629577 ATTTGTCTACCTATTGTCAGTGG - Intergenic
983218444 4:165022175-165022197 ATTTTTTTACATACTCTTTTGGG + Intergenic
983389808 4:167115203-167115225 ATCTGGTTACATATTATCTGTGG + Intronic
983718126 4:170811160-170811182 ATTCATTTACATACTGTCTATGG + Intergenic
983911454 4:173244127-173244149 ATTCATTTACATATTGTCTATGG + Intronic
983930132 4:173444475-173444497 ATTCATTTATATATTGTCTGTGG - Intergenic
984051980 4:174875625-174875647 ATTTGTTTACATATTGTCTGTGG + Intronic
984239633 4:177202221-177202243 ATTTATTTACATATTTTCTGTGG - Intergenic
984253060 4:177357728-177357750 ATTTGTTTAGATATTATCTATGG + Intronic
984367288 4:178815753-178815775 ATTTGCTTACATTTTGGCTGTGG - Intergenic
984536979 4:180988691-180988713 ATTTGTTTACATATATTCTGTGG - Intergenic
984643127 4:182192161-182192183 TTTTTTTTACATCTTGTCTGTGG + Intronic
986770933 5:10973075-10973097 AATAGTTTACACACTGTGTGGGG - Exonic
986951280 5:13087719-13087741 ATGTGTTCACATACTCTCAGAGG + Intergenic
987023814 5:13902648-13902670 ATTTGTTTGTGTACTGTCTATGG - Intronic
987109894 5:14675943-14675965 ATTAATTTACATATTGTCTGTGG + Intronic
987183313 5:15388301-15388323 ATGTGTTGACTTATTGTCTGTGG - Intergenic
987234190 5:15927196-15927218 CTTTGTTTACACTCTGTTTGTGG + Intronic
987257520 5:16171615-16171637 ATTTATTTATACAGTGTCTGTGG + Intronic
987267571 5:16273319-16273341 ATTTGTTTAAATATTGTCCATGG - Intergenic
987287424 5:16470906-16470928 ATTTGTTTATGTATTGTCTATGG - Intergenic
987372477 5:17206245-17206267 ATTTGTTGACACATTGTCTGTGG + Intronic
987419860 5:17706756-17706778 ATTTGTTTTCATATGGTCTAGGG + Intergenic
987468417 5:18299955-18299977 ATCTGTTGACATAATGTCTAGGG + Intergenic
987607828 5:20161000-20161022 GTTTGTTCACATACTGACTGTGG + Intronic
987752327 5:22057178-22057200 ATTTGTTTCAATATTGTCTATGG - Intronic
987882587 5:23768452-23768474 ATTTTTTTACATATTTTCTATGG + Intergenic
987947083 5:24624334-24624356 ATTTATTTAAATATTGTTTGAGG - Intronic
989120527 5:38000076-38000098 ATTCGTTTATATCTTGTCTGTGG + Intergenic
989213687 5:38882231-38882253 ATTGGTTTACACACTATCTATGG - Intronic
989223838 5:39002660-39002682 GTTTGTTTTCATACAGTTTGCGG - Exonic
989362322 5:40616667-40616689 ATTTCTTTACTTTCTGTCTTAGG - Intergenic
989391103 5:40901867-40901889 ATGTGTGTACATACTGTCGTTGG + Intergenic
989414463 5:41157509-41157531 ATATGTTTACATATCGTCTATGG - Intronic
990291961 5:54361153-54361175 ATCTGTTTACATATTGTCTATGG + Intergenic
990611904 5:57466085-57466107 ATTTATTTACATATTGCCTATGG + Intergenic
990818772 5:59814237-59814259 ATTTGTTTACTTATTGTCTGTGG + Intronic
990930875 5:61090327-61090349 ATTTGTTTACATATTATTTGTGG - Intronic
991019983 5:61970527-61970549 GTTTGTTTACAAATTGTCTATGG - Intergenic
991311305 5:65245802-65245824 ATTTATTTACATATTGTCTGTGG - Intronic
991380283 5:66015417-66015439 ATTCATGTACATATTGTCTGTGG + Intronic
991911054 5:71561584-71561606 ATCTGTTTACATATGGTCTATGG - Intronic
991988613 5:72315906-72315928 ATTTGTTTACAAATTTTCTGTGG - Intronic
992338904 5:75801390-75801412 ATTTGTTTACTTATTGCCTATGG + Intergenic
992375109 5:76181243-76181265 ATCTGTTTACATGTTGTCTATGG + Intronic
992681500 5:79157899-79157921 ATTTGTTTTCATATTGTCTATGG + Intronic
992761500 5:79954814-79954836 ATTAGCTTACGTATTGTCTGTGG - Intergenic
992818963 5:80475103-80475125 ATTTGTTTACATACTGTGAATGG - Intronic
992858244 5:80886183-80886205 ATTTGTTTCTATAGTGTCTGTGG + Intergenic
992899990 5:81284983-81285005 ATTCATATACATATTGTCTGTGG + Intergenic
993258824 5:85630560-85630582 ATATATTTACATATTGTCTATGG + Intergenic
993267824 5:85750475-85750497 ATTTGTTTACATATTATCTATGG - Intergenic
993573869 5:89577541-89577563 ATTCATTTACATATTGTCTATGG + Intergenic
993998191 5:94747531-94747553 ATTTGTTTTCTTACTATCTACGG - Intronic
994152005 5:96458263-96458285 ATTTGTTTATATGTTGTCTATGG + Intergenic
994654888 5:102580253-102580275 ATTTGTTTACATATTGTCAATGG - Intergenic
994720703 5:103376688-103376710 ATTTGTCTGCATATTGTCTGTGG + Intergenic
994819850 5:104635059-104635081 ATTTGTGGAAATACTGTCTGTGG + Intergenic
994841283 5:104928355-104928377 ATTCATTTACATATTGTCTATGG + Intergenic
994945816 5:106389560-106389582 ATTTGTTTACATATTGATTATGG + Intergenic
995127830 5:108597330-108597352 ATTCATTTAAATACTGTCTATGG + Intergenic
995377405 5:111491236-111491258 ATTTATGTACATATTGTTTGTGG + Exonic
995394366 5:111671715-111671737 ATTCTTTCACGTACTGTCTGTGG - Intronic
995422438 5:111982318-111982340 AATTGTTTACATATTGTCTGTGG + Intronic
995454698 5:112338791-112338813 ATTGTTTTACACATTGTCTGTGG + Intronic
995610587 5:113906404-113906426 ATTTGTCTGTATACTGTCTATGG + Intergenic
995755270 5:115496757-115496779 ATTCATTTACATAATGTCTATGG - Intergenic
995819359 5:116210636-116210658 ATTTGTTGATAGACTGTATGTGG - Intronic
995876861 5:116799574-116799596 TTTTGTTTACACACTGTCTGTGG - Intergenic
995947999 5:117673178-117673200 TTTTGTTTATGTATTGTCTGTGG + Intergenic
995989149 5:118214618-118214640 ATTTGTTAACTTAGTGTCTGTGG - Intergenic
996076281 5:119198379-119198401 ATTTGTGTACATGTTGTCTATGG - Intronic
996078090 5:119221567-119221589 ATTTGTTTCCATTTTGTCTGTGG + Intronic
996176021 5:120358898-120358920 ATTTGTTTAAATATAGTCTATGG - Intergenic
996378475 5:122840345-122840367 GTTTGTTTTCATCCTGTGTGGGG + Intergenic
996566901 5:124889856-124889878 ATTTTTATACATACTGTATTTGG - Intergenic
997021512 5:130007999-130008021 ATGTGGTTACACACTGGCTGGGG - Intronic
997123954 5:131206864-131206886 ATTTGTTTACATATTGTCTATGG + Intergenic
997318280 5:132956259-132956281 TTTTGTTTATGTATTGTCTGTGG - Intronic
997857557 5:137385939-137385961 ATTTGTTTACATGTCGTCTGTGG - Intronic
998052782 5:139050004-139050026 ATTTGTTTACATATTGTCTATGG - Intronic
998181133 5:139943897-139943919 ATTTGTTTGCATATTGTTTATGG - Intronic
998196875 5:140081197-140081219 ATTTGCTTACCTATTGTCTATGG - Intergenic
998479557 5:142451486-142451508 ATTTGTTTGCCTATTGTCTAGGG + Intergenic
998646905 5:144072153-144072175 ATTTGTTTACATAGTATATTCGG + Intergenic
999115204 5:149156814-149156836 ATTTCTTTACACATTGTCTATGG - Intronic
999196504 5:149785029-149785051 ATCTGTTTATATACTCTCTCAGG + Intronic
999209880 5:149878666-149878688 ATTTGCTTACATACTGTGTCGGG - Intronic
999575641 5:152973469-152973491 AGTCATTTACATATTGTCTGTGG - Intergenic
999637362 5:153636471-153636493 ATTTGTTTACATATTGTCTTTGG + Intronic
999855750 5:155591765-155591787 ATTTGTTTATGTAGTGTCTGTGG - Intergenic
999868106 5:155723531-155723553 ATTTTTTAACTTACTGTCTCTGG - Intergenic
999916916 5:156272863-156272885 ATTTGTTTATGTATTGTCTGTGG + Intronic
999929430 5:156414597-156414619 ATTTATTTACACAGTGTCTGTGG - Intronic
999969681 5:156846640-156846662 ATTTGTTTAAATATTGTTTATGG + Intergenic
1000129138 5:158278331-158278353 ATTCATTTACATATTGTCTGTGG + Intergenic
1000150379 5:158494711-158494733 TTTTGTTTACATATTATCTATGG - Intergenic
1000156490 5:158557397-158557419 CTTTTTTTACGTATTGTCTGTGG + Intergenic
1000242050 5:159417768-159417790 ATTCATTTACATACTATCTCTGG - Intergenic
1000272611 5:159700868-159700890 ATTTCTTTGCATATTGTCTATGG - Intergenic
1000418759 5:161013047-161013069 ATTTTTTTACATACTATCTATGG - Intergenic
1000894500 5:166839176-166839198 ATGTATATACATATTGTCTGTGG - Intergenic
1000897307 5:166871248-166871270 ATTGGTTTTCATGCTGTATGTGG + Intergenic
1000910626 5:167017475-167017497 ATCTGTTTACATATTGTCTATGG - Intergenic
1000955662 5:167540514-167540536 ATTCGTTTATGTACTGTCTGTGG + Intronic
1001010387 5:168092391-168092413 ATCTGTTTACATATTGTCTATGG + Intronic
1001055615 5:168447426-168447448 ATTGGTTTACATACTGTCTACGG - Intronic
1001119028 5:168963480-168963502 ATTTCTTTACAGAGTGTCTATGG + Intronic
1001126011 5:169020061-169020083 GTTTTTTTACATATCGTCTGTGG + Intronic
1001154437 5:169261009-169261031 ATTTATTTATATATTGTCTAAGG - Intronic
1001409655 5:171501695-171501717 ATTCATTTACATATTGTCTCTGG + Intergenic
1002025013 5:176390844-176390866 ATTTGTGTACATAGTGTTTGAGG + Intronic
1002286337 5:178165056-178165078 ATTTGATTACATATTGTCTCTGG - Intergenic
1002838702 6:887439-887461 AGTCGTTTACACATTGTCTGTGG + Intergenic
1002838951 6:889323-889345 ACTTGTTTACATTTTGTCAGTGG + Intergenic
1003091925 6:3111616-3111638 ATTCATGTACATATTGTCTGTGG - Intronic
1003128713 6:3377137-3377159 ATTTGTTTACATATCATCTGTGG + Intronic
1003129431 6:3382672-3382694 ATTTGTTTACATATCATCTATGG + Intronic
1003304444 6:4913797-4913819 ATTTGTTTACCTGTTGTCTTTGG - Intronic
1003576809 6:7304358-7304380 ATTCATTTACGTATTGTCTGAGG - Intronic
1003716109 6:8647935-8647957 TTATGTTTCCATATTGTCTGTGG - Intergenic
1003943200 6:11048707-11048729 TTATGTTTACGTATTGTCTGTGG + Intergenic
1004046290 6:12027037-12027059 ATTTATTTACATACTGACCATGG + Intronic
1004048746 6:12051965-12051987 ATGAGTTTACATACTGTGTGGGG + Intronic
1004057201 6:12151769-12151791 ATTTCTTTATATACTGTCTGTGG - Intronic
1004201375 6:13551230-13551252 ATGTGTTTACATATTGTGTTGGG + Intergenic
1004311983 6:14553939-14553961 ATTTGTTCACATACTGTCTGTGG + Intergenic
1004338629 6:14787279-14787301 ATTTGTTTGCATATTGTTTATGG + Intergenic
1004470108 6:15921448-15921470 ATTTGTTTACATATTGTCTGTGG - Intergenic
1004471108 6:15929919-15929941 ATTTAGTTACATAATGTCTGTGG - Intergenic
1004492980 6:16134757-16134779 ATTTGATTAAATACTTTCTTTGG - Intronic
1004922346 6:20387734-20387756 ATTTGTTTACCTATTGTCTGAGG - Intergenic
1004966060 6:20853042-20853064 ATTTATTTGCATATTTTCTGTGG - Intronic
1005257296 6:24016529-24016551 ATCTGCTTACACATTGTCTGTGG + Intergenic
1005586119 6:27278099-27278121 ATCTGTTTCCATACTCTATGAGG - Intergenic
1005907086 6:30272123-30272145 ATTTGTTTACCTACTTACTTAGG - Intergenic
1006569376 6:34988192-34988214 ATTTATTTACATATCATCTGTGG + Intronic
1006714879 6:36111246-36111268 ATCTGTTTATGTATTGTCTGTGG + Intergenic
1007052754 6:38848977-38848999 ATTCTTTTATATATTGTCTGTGG + Intronic
1007242384 6:40436343-40436365 ATTTGTTTACATATCGCATGTGG + Intronic
1007957553 6:45931140-45931162 ATTTGTTTACATATTATCTGTGG + Intronic
1008043304 6:46825652-46825674 ATTTGTTTAAGTATTGTCTATGG + Intronic
1008161759 6:48086190-48086212 ATTTGTTTACACATTGTCAGTGG - Intergenic
1008242403 6:49128808-49128830 ATTGATTTACATACTGTCTATGG + Intergenic
1008342793 6:50388135-50388157 ATTTGCTTTTATATTGTCTGTGG - Intergenic
1008428440 6:51386566-51386588 AGTTGTTTACATACTGTCTGTGG + Intergenic
1008479204 6:51967240-51967262 ATTCATTTACATATTGTTTGTGG + Intronic
1008595575 6:53038711-53038733 ATTCATTTATATACTGCCTGTGG + Intronic
1008620530 6:53266937-53266959 ATTCATTTACATATTGTCTATGG + Intergenic
1008868553 6:56245377-56245399 ATTTGATTACATACTTTATATGG - Intronic
1008928595 6:56913489-56913511 ATTCATTTACATATTGTCTATGG + Intronic
1008948529 6:57127952-57127974 ACTTGTTTACATATTGTCTGTGG + Intronic
1009466683 6:63979214-63979236 ATTTGTTTACATTTTGTCAGTGG + Intronic
1009588193 6:65633829-65633851 ATTCATTTACATATTGTCTATGG + Intronic
1009875698 6:69502170-69502192 ATTTGTTTATGTACTTTTTGAGG - Intergenic
1009878435 6:69535334-69535356 ATTTGTTTACATATTGTTTATGG + Intergenic
1009923052 6:70087036-70087058 ATTTGCTTACATATTGCCTTTGG + Intronic
1009934635 6:70219396-70219418 ATTTGTTTACATATTGTCTGTGG + Intronic
1010035537 6:71321479-71321501 ATTTGTTTACATATCATCTTTGG - Intergenic
1010100096 6:72094616-72094638 ATTCATTTACATACTATCTGTGG + Intronic
1010105034 6:72157752-72157774 ATTTTCTTACATACTGTAGGTGG + Intronic
1010404115 6:75483458-75483480 ATTTGTGTTCAGAATGTCTGGGG + Intronic
1010612821 6:77975962-77975984 ATTCATTTACATATTGTCTGCGG - Intergenic
1010700638 6:79041161-79041183 AGTTGTTTATATATTGTCTATGG - Intronic
1010787841 6:80025679-80025701 ATTTGTTTACATATTGTCTATGG - Intronic
1010859167 6:80884564-80884586 ATTCTTTTATGTACTGTCTGTGG + Intergenic
1011053156 6:83176485-83176507 ATTTGTTTATGTATGGTCTGTGG - Intronic
1011220606 6:85050962-85050984 ATTTGCTTACATATTGTCTATGG + Intergenic
1011249490 6:85355956-85355978 ATTTGTTTGCATATTATCTGAGG + Intergenic
1011496168 6:87938480-87938502 CTTTGTTTACATCTTGTGTGGGG + Intergenic
1011636700 6:89381191-89381213 ATTTGCTTTCATATTGTCTAAGG + Intronic
1011942104 6:92856123-92856145 ATTTGTTTACCTACTGCATGGGG + Intergenic
1012052834 6:94364782-94364804 ATTTGCTTACATACTGGATGTGG - Intergenic
1012339481 6:98102094-98102116 ATTTTTTAAAATACTTTCTGTGG + Intergenic
1012856226 6:104505182-104505204 ATTTGTTTACATATTGTCCAAGG + Intergenic
1012908358 6:105092846-105092868 ATTTGTGTAGAGACTGGCTGAGG - Intergenic
1012931557 6:105322649-105322671 ATTTGTTTACATATTGCCTGTGG - Intronic
1013062739 6:106652921-106652943 TTTCATTTACATATTGTCTGTGG - Intronic
1013257647 6:108405197-108405219 ATTTCTTTACATTCAGTTTGAGG + Intronic
1013416824 6:109933139-109933161 ATTTGTTTACATATTGTCTATGG + Intergenic
1013455409 6:110325370-110325392 ATTTGTTTACTTACTGTCTATGG - Intronic
1013738610 6:113257461-113257483 ATTAGTTTACATATTGGTTGTGG - Intergenic
1014189708 6:118480637-118480659 AGTTTTTCATATACTGTCTGTGG - Intronic
1014228843 6:118879561-118879583 ATTTGTTTACATACTGTCTATGG + Intronic
1014257800 6:119181109-119181131 TGTTGTTTAAATATTGTCTGTGG + Intronic
1014300790 6:119678927-119678949 ATTCGTTTACATACTGTTTTTGG + Intergenic
1014349993 6:120329179-120329201 ATGTGTGTGCATACTGTGTGTGG - Intergenic
1014543944 6:122710567-122710589 ATTTGCTTACTTATTTTCTGGGG + Intronic
1014600238 6:123402182-123402204 GTTTGTTTACATACTGAGTTAGG - Intronic
1014835830 6:126159374-126159396 ATTTGTTTACGCATTGTCTATGG - Intergenic
1015140002 6:129920243-129920265 ATTTGCTTACATATTGTCTATGG - Intergenic
1015154633 6:130078786-130078808 ATTGGTTTACCTATTGTCTATGG - Intronic
1015190743 6:130469083-130469105 ATTAGTTTAAATAGTATCTGTGG + Intergenic
1015283514 6:131459144-131459166 ATTTATTTACATATTGTCTATGG - Intergenic
1015302595 6:131670910-131670932 ATTTGTTTATTTATTGTCTATGG + Intronic
1015805852 6:137107596-137107618 ATTTGTTAACATATGGTCTATGG + Intergenic
1015846879 6:137530191-137530213 ATTTGTTTACTTATTGTCTGTGG + Intergenic
1016079718 6:139841029-139841051 ATTTGTTTACATATTGCCTACGG - Intergenic
1016097326 6:140054687-140054709 ATTTGTTTATGTATTGTCTAAGG - Intergenic
1016262650 6:142190830-142190852 ATTTTTTTACATATTATCTATGG - Intronic
1016355710 6:143215929-143215951 ATTCGTTTATGTATTGTCTGTGG - Intronic
1016366960 6:143329838-143329860 ACTCGTTTACATATTGTCTATGG + Intronic
1016378211 6:143445820-143445842 ATTTGTTGAAATGGTGTCTGTGG + Intronic
1016471393 6:144378394-144378416 ATTTGATTACATATTGTTTTGGG - Intronic
1016605276 6:145914511-145914533 ATTCATTTACGTATTGTCTGTGG - Intronic
1016606054 6:145928122-145928144 ATTTGTTTTTATACTGCCTGTGG + Intronic
1016695141 6:146985338-146985360 ATTTGTTTACACAGTGTCTATGG - Intergenic
1016712774 6:147192453-147192475 AGTTGTTTACATATTATCTACGG + Intergenic
1016929911 6:149394934-149394956 ATTTGTTTACTTGTTGTCTATGG - Intronic
1017538602 6:155375909-155375931 ATTTGTTTACATAGTGTCTATGG - Intergenic
1017703951 6:157103015-157103037 TTTTGTTTTCATATTGTCTGTGG + Intronic
1017711945 6:157177868-157177890 GTTTGTTTGCCTACTGTCAGTGG + Intronic
1017797550 6:157860016-157860038 ATTTGTTTATATATTGTCTGTGG + Intronic
1018330475 6:162722125-162722147 ATTTGTCTATATATTGCCTGTGG - Intronic
1018503198 6:164435362-164435384 ATTTATTAATATACTGCCTGAGG + Intergenic
1018811441 6:167301014-167301036 ATTTGCTTACATGTTGTCTATGG - Intronic
1018896018 6:168017822-168017844 CTTTGTTTACAGACTGTGTATGG - Intronic
1020152410 7:5693203-5693225 ATTTGTTTACATATTGTCTGTGG + Intronic
1020352249 7:7233666-7233688 ATTCATTTATATACTGACTGCGG - Intronic
1020381699 7:7554866-7554888 ATTTGTTTATGTACTATCTATGG + Intergenic
1020506276 7:8992764-8992786 ATTATTTTCCAGACTGTCTGAGG + Intergenic
1020699191 7:11456729-11456751 ATTTTTTTACATATTGCCTATGG - Intronic
1020902540 7:14023975-14023997 ATTTATTCACACACTGTCTATGG - Intergenic
1020930267 7:14384385-14384407 ATATGGTTACATATTGTCAGTGG + Intronic
1020988740 7:15169288-15169310 ATTTGTTTGCATATTGTCTGTGG - Intergenic
1020993730 7:15234709-15234731 CTTTGTTTACAGACTGTCTATGG - Intronic
1021262064 7:18470662-18470684 ATTTATTTACATATTATCTATGG - Intronic
1021504536 7:21367261-21367283 ATTTGTTTACATAATGTCCATGG - Intergenic
1021626394 7:22597151-22597173 ATTCATTTACATGTTGTCTGTGG - Intronic
1021750273 7:23791903-23791925 ATTTGTTTACATACTGTCTATGG - Intronic
1021770917 7:24000268-24000290 ATTTGTTTACATACTATCTGTGG - Intergenic
1021850321 7:24801685-24801707 ATTTGTTTAAATACTGTTTATGG + Intronic
1022063440 7:26824734-26824756 ATTTGTTTACATATTGTCTATGG - Intronic
1022161859 7:27719104-27719126 AGTTGTTTACCTTCTGCCTGTGG + Intergenic
1022390486 7:29939602-29939624 ATTTATTTATATATTGTTTGGGG - Intronic
1022455827 7:30557463-30557485 ATTTGTTTACATATTGTCTATGG + Intergenic
1022605794 7:31812633-31812655 ATTTGTTTGTATATTATCTGTGG + Intronic
1022607178 7:31826927-31826949 ATTCATTTACATATTGTCTATGG - Intronic
1022714346 7:32884840-32884862 ATTTGTTTCCATATTGTCTTTGG - Intronic
1022944383 7:35267382-35267404 ATTTGTTTACATATTGTCTATGG - Intergenic
1023068971 7:36409398-36409420 ATTTACTTACATATTCTCTGTGG + Intronic
1023145787 7:37149581-37149603 ATTGATTTGCATACTGTCTGTGG + Intronic
1023317112 7:38950399-38950421 ATTTGTTTATGTAGTGTCTACGG - Intergenic
1023342688 7:39238468-39238490 ATTTGTTTACGTATTGTTTGCGG + Intronic
1023616070 7:42021128-42021150 ACCTTTTTACTTACTGTCTGAGG - Intronic
1023622053 7:42083496-42083518 ATTTGTTTACATATTGCCTATGG + Intronic
1023790156 7:43747509-43747531 CATTGTTTACATATTGTCTGTGG + Intergenic
1024467905 7:49732335-49732357 ATTTGTTTCTGTATTGTCTGTGG - Intergenic
1024600751 7:50978813-50978835 ATATGTTTACATATTGTCTGTGG + Intergenic
1024696780 7:51866222-51866244 ATGTGTTTACATATTTTCTGTGG - Intergenic
1026074284 7:67152119-67152141 TCTTGTTTACATATTGTCTGTGG + Intronic
1026145415 7:67742342-67742364 ATTCATTTACATATTGTCTATGG - Intergenic
1026291059 7:69006575-69006597 ACCTGTTTACATATTGTCTACGG + Intergenic
1026702584 7:72660057-72660079 TCTTGTTTACATATTGTCTGTGG - Intronic
1026903135 7:74048007-74048029 ATTTGTTTTCACTCTGGCTGGGG + Intronic
1027571890 7:79879344-79879366 ATTTGTCTAAAGACTGACTGTGG - Intergenic
1027787737 7:82601407-82601429 TTTTGTTTATCTACTGTCTAAGG - Intergenic
1027846077 7:83377466-83377488 ATTTGTTTACCTAAAGTCTGTGG - Intronic
1027957624 7:84901490-84901512 ATTTCTATACACAATGTCTGTGG + Intergenic
1028111958 7:86951176-86951198 ATTCATTTACCTACTGTCTATGG + Intronic
1028447125 7:90937722-90937744 ATTTGTTGAGATGGTGTCTGTGG - Intronic
1028885838 7:95931670-95931692 ATTTATTTACATATTGTCCCTGG + Intronic
1029018244 7:97337158-97337180 ACTTGTTTACCTACTGAATGTGG + Intergenic
1029040457 7:97567560-97567582 ATTTGTTTACATTGTATCTTTGG + Intergenic
1029055703 7:97739388-97739410 ATTCATTTACATATTGTCTATGG - Intronic
1029637357 7:101793927-101793949 ATTGGTGTACATGGTGTCTGGGG + Intergenic
1029659537 7:101950607-101950629 ATTTGTTTATCTATTGTCTGTGG + Intronic
1029791438 7:102847084-102847106 ATTTATTTACATATTGTCTATGG + Intronic
1029819210 7:103129350-103129372 ATATGCTTACATGCTGGCTGGGG - Intronic
1029934046 7:104404002-104404024 ATTTGTTTACGTACTGTCTGTGG + Intronic
1030072337 7:105708866-105708888 ATTTGTATACAGAATGTCTTAGG + Intronic
1030485216 7:110156949-110156971 ATTTATTTTCAAACTCTCTGTGG - Intergenic
1031093901 7:117395938-117395960 ATTTGTTTATGTATTGTCTATGG - Intronic
1031600791 7:123706142-123706164 ATTGGTTTACATGTTGTCTTTGG - Intronic
1031856259 7:126926531-126926553 AATAGTTGACATACTGTATGTGG + Intronic
1032424704 7:131813079-131813101 ATTTGTTTACATATCGTCTATGG + Intergenic
1032503728 7:132419807-132419829 ATTTGTTTATGTATTGTCTGTGG - Intronic
1033010993 7:137622615-137622637 AGTTATTTATATATTGTCTGTGG - Intronic
1033381779 7:140827824-140827846 ATCTGTTTATATGTTGTCTGTGG - Intronic
1033727132 7:144130864-144130886 ATTTGTTTACACATTGTCTATGG - Intergenic
1033856417 7:145566675-145566697 ATTCGTTTACATACTGTTTATGG - Intergenic
1033861391 7:145632294-145632316 ATTTATTTACATATTGTCTGTGG + Intergenic
1035568131 8:655301-655323 ATTTGCTTACAACCTGCCTGTGG - Intronic
1036505782 8:9354309-9354331 ATCTGTGTACTTACTGTCTGTGG - Intergenic
1036545860 8:9769174-9769196 ATTCATTTACATATAGTCTGTGG - Intronic
1036942099 8:13061410-13061432 CATTGTTTGCATATTGTCTGTGG + Intergenic
1036978201 8:13438975-13438997 ATTTGTATACATAGTGTCTATGG - Intronic
1037083383 8:14815602-14815624 ATTTCTATACATACTCTGTGTGG - Intronic
1037495701 8:19438680-19438702 GTTTGTTTACATATTATTTGTGG - Intronic
1037653268 8:20860138-20860160 AGTTGTTTACATATTATCTGTGG - Intergenic
1038557647 8:28537567-28537589 ATTTGCTGACTTACTGTCTATGG - Intronic
1038727183 8:30092555-30092577 ATTTGTTTACACATTTTTTGGGG + Intergenic
1038891100 8:31724963-31724985 ATTTGTTTATGTACTATCTATGG - Intronic
1039009678 8:33079100-33079122 ATTGGTTTACCTAATGTCTATGG + Intergenic
1039261604 8:35777667-35777689 ATTTGTTTACAGACTCTCTCTGG - Intronic
1039268594 8:35855265-35855287 ATTTGTGTAGATTCTGTCAGAGG - Intergenic
1039701027 8:39962040-39962062 ATTTGTTTACATGCTATCTATGG - Intronic
1039771627 8:40693701-40693723 ATTCATTTACATATTGTCTGTGG - Intronic
1039946453 8:42133339-42133361 CTTTGTTTCTATACTTTCTGGGG + Intergenic
1041226479 8:55705373-55705395 ATTTGTCTACATATTGTCTATGG + Intronic
1041273726 8:56135796-56135818 ATTTGTTTACATACTGCCTGTGG + Intergenic
1041434574 8:57824065-57824087 ATTTGTTTACATATTGTCTATGG + Intergenic
1041444922 8:57940526-57940548 ATTTGTCTACATATTGCCTGTGG + Intergenic
1041480314 8:58312752-58312774 ATTTGTTTGCATATTTTCTGTGG - Intergenic
1041509248 8:58636682-58636704 ATTTGTGTACATACTGTGTGTGG - Intronic
1042132836 8:65605959-65605981 ACTTGTTAACATATTATCTGAGG + Intronic
1042286281 8:67115057-67115079 ATTCCTTGACATACTGTTTGTGG + Intronic
1042420947 8:68588945-68588967 ACTCATTTACATACTGTCTGTGG - Intronic
1042570182 8:70155647-70155669 GTTTGTTTACACAGTGTCTGTGG + Intronic
1042638719 8:70908649-70908671 ATTTGTTTACATAGTGTCTATGG - Intergenic
1042834088 8:73062168-73062190 ATTTGTTTGTTTACTTTCTGGGG + Intergenic
1042838455 8:73099403-73099425 ATTTGTTTCCATATTGTCTATGG + Intronic
1042925805 8:73967375-73967397 AATCGTTTACATCTTGTCTGTGG - Intronic
1042985923 8:74582829-74582851 ATCTGTTTACATATTGTCTCTGG - Intergenic
1043564892 8:81536834-81536856 ATTCCTTTACATATTGTCTATGG + Intergenic
1043662108 8:82756500-82756522 ATTTTTTTACTTAATGTCTTGGG - Intergenic
1044095904 8:88064104-88064126 ATTTATTTACATATTGTGTATGG + Intronic
1044501120 8:92958946-92958968 ATTTGTTTACGTATTGTCTATGG - Intronic
1044964113 8:97558282-97558304 ATTTGTTTAGGTATTGTCTGTGG + Intergenic
1045022480 8:98055799-98055821 ATTCCTTTACATATTGTCTATGG - Intergenic
1045238141 8:100374274-100374296 ATTTATTTACATAGTGTCTATGG - Intronic
1045262425 8:100588491-100588513 ACTTGTTTATATACTGCCTATGG + Intronic
1045275711 8:100703487-100703509 ATTTGTATACATACTATCTATGG + Intronic
1045382210 8:101638470-101638492 ATTTGTTTATGTATTGTCTGTGG + Intronic
1045484083 8:102617009-102617031 ATTTGTTTACATATTGTCTATGG - Intergenic
1045653030 8:104359828-104359850 ATTTGTCTACTTATTGTCTATGG - Intronic
1045763828 8:105643951-105643973 ATTTGTTTATACATTGTCTATGG + Intronic
1045781249 8:105865624-105865646 GTTTGTTTACATATTGTCCATGG - Intergenic
1045895021 8:107205296-107205318 ATTCATTTACATATGGTCTGTGG + Intergenic
1045961154 8:107970183-107970205 AATCATTTACATATTGTCTGTGG - Intronic
1046929604 8:119828926-119828948 ATTTATTTACATATTGACTGTGG - Intronic
1046964502 8:120148951-120148973 ATTTGTTTACATATTGTCTGTGG + Intronic
1046966723 8:120175636-120175658 ATTCCTTTACATATTGTCTATGG + Intronic
1047025842 8:120823678-120823700 ATTCGTTTACATGTTGTCTATGG + Intergenic
1047161979 8:122390916-122390938 ATTCATTTACGTATTGTCTGTGG - Intergenic
1047281103 8:123446440-123446462 ATTCATTTACATATTGTCTGTGG - Intronic
1047425724 8:124743901-124743923 ATTTATTTACATATTTTCTATGG + Intergenic
1047425858 8:124745940-124745962 ATTTATTTACATATTTTCTACGG + Intergenic
1047466682 8:125122922-125122944 ATTTGTTTACATATTGTTTATGG - Intronic
1047577854 8:126177889-126177911 ATTTGTTTCCATATTGTCTACGG - Intergenic
1047706837 8:127507581-127507603 ATTTGTTTACGTATTATCTATGG + Intergenic
1047712573 8:127567175-127567197 ATTCATTTACATACTGTCTATGG + Intergenic
1048143506 8:131819008-131819030 ATTTGTTTACATATTATCCATGG - Intergenic
1048151165 8:131896137-131896159 ATGACTTTGCATACTGTCTGTGG + Intergenic
1048181621 8:132200310-132200332 ATTTGTTTAATTATTGTCTATGG + Intronic
1048203124 8:132393439-132393461 CTTTGTTTACATGTTGTCCGTGG - Intronic
1048409552 8:134157883-134157905 ATTTATTTACATATTATCTACGG - Intergenic
1048555127 8:135468565-135468587 ATTCATTTACATAGTGTCTGTGG - Intronic
1048606581 8:135974667-135974689 ATTTGTTTACATATTATCAATGG - Intergenic
1048733898 8:137476298-137476320 ATTTATTTACATATTATCTGTGG - Intergenic
1049141964 8:140962983-140963005 AATTGTTTATATATTGTCTATGG - Intronic
1049336048 8:142086207-142086229 ATTTGTTTAAGGACTGTCTATGG - Intergenic
1049524917 8:143119488-143119510 ATTTGTTTCCATCTTGTCTCTGG - Intergenic
1050042034 9:1506055-1506077 CTTTGTTTTCATACTTTCTTTGG - Intergenic
1050259135 9:3822671-3822693 ATTTGTTTGCATAATATCTACGG + Intergenic
1050331552 9:4550905-4550927 AATCATTTACATACGGTCTGTGG - Intronic
1050767043 9:9147619-9147641 ATTTGTTTACCTATTGTCTATGG + Intronic
1050849522 9:10265628-10265650 ATTTATTTACTTGTTGTCTGTGG - Intronic
1051054797 9:12972205-12972227 ATTTGTTTACAGAAAGACTGAGG + Intergenic
1051203414 9:14657606-14657628 TTTTGTTTATATATTGTCTATGG - Intronic
1051207091 9:14699412-14699434 ATTCATTTACATATTGTCTATGG - Intergenic
1051301661 9:15657987-15658009 ATTTGTTTACATATTGTTTATGG + Intronic
1051599686 9:18860398-18860420 ATTTGTTTATGTATTGTCTATGG + Intronic
1051841667 9:21404690-21404712 AATTGTTTCCTTATTGTCTGAGG + Intergenic
1052086750 9:24276468-24276490 ATTTATTAACATACTTTCTATGG + Intergenic
1052124472 9:24757926-24757948 ATTTGTGTAAATACTGTTTGTGG + Intergenic
1052633227 9:31067754-31067776 TTTTCATTACATAATGTCTGGGG - Intergenic
1052789646 9:32863291-32863313 ATTTGTTTATGTATTGTCTGTGG - Intergenic
1053027591 9:34742934-34742956 ATTTGTTGATGTATTGTCTGTGG + Intergenic
1053134235 9:35639789-35639811 GGTTGTTTACATGCTGGCTGGGG + Intronic
1053336083 9:37273095-37273117 ATTTGTGTATATATTGTCTGTGG + Intronic
1053447743 9:38165964-38165986 ATTTGTTCATGTACTGTCTGTGG + Intergenic
1054747516 9:68869571-68869593 ATTCATTTACAAATTGTCTGCGG + Intronic
1054981293 9:71209836-71209858 ATTCATTTACATTCTGTCTATGG + Intronic
1055016569 9:71624910-71624932 ATTTGTTTACATGTTGTCTTTGG - Intergenic
1055087267 9:72326877-72326899 TTTTGTTTACATATTGTCCATGG - Intergenic
1055473211 9:76634407-76634429 TTTTGTTTACATACTATGTTAGG - Intronic
1055535310 9:77236507-77236529 ATTTGTTTACCTACTGTAGTGGG + Intronic
1055610111 9:78013834-78013856 ATTTATTAACAAACTGTTTGTGG + Intronic
1055655913 9:78450410-78450432 ATTTGTTGAAATAGTGTCTGTGG + Intergenic
1055687299 9:78790451-78790473 ATTTATTTACATATTATCTATGG - Intergenic
1055749809 9:79492579-79492601 ATTTATTTACATACTGTCTATGG - Intergenic
1055906939 9:81305912-81305934 ATTTATTTACAGATAGTCTGTGG + Intergenic
1056083444 9:83121545-83121567 CTTTATTTACATATTGTCTATGG + Intergenic
1056145482 9:83724618-83724640 ATTCATTTACATATTGTCTATGG - Intergenic
1056218720 9:84430233-84430255 ATTCATTTACATACTATCTGTGG - Intergenic
1056233130 9:84567075-84567097 ACTCATTTCCATACTGTCTGTGG + Intergenic
1056250822 9:84746278-84746300 GTTCATTTACGTACTGTCTGTGG + Intronic
1056347375 9:85711843-85711865 ATTCATTTACATATTGTCTGTGG - Intronic
1056385830 9:86096293-86096315 ATTCATTTACATATTATCTGTGG + Intronic
1056471317 9:86906644-86906666 ATTTTTTTAAAAACTGTCTAAGG - Intergenic
1057095410 9:92303460-92303482 ATTTGTTTACATATTGTCTATGG + Intronic
1057387524 9:94617172-94617194 ATTTTTTCACATACTGCCTTTGG - Intronic
1057556131 9:96089142-96089164 ATTTGTTCACATACTGTCTCTGG - Intergenic
1057712489 9:97459244-97459266 ATTTATTTACATATTCTCTCTGG - Intronic
1057765597 9:97915410-97915432 ATTTGTTTAAGTATTGTTTGTGG - Intronic
1058014452 9:100014691-100014713 ATTTGTTTACATATTGTCTAAGG + Intronic
1058107654 9:100990995-100991017 ATGTATTTACATATTGTCTGTGG + Intergenic
1058168666 9:101651510-101651532 ATTTGATTACATATTTTCTGAGG + Intronic
1058451655 9:105101973-105101995 ATTAATTTACATACTGTCTATGG + Intergenic
1058478950 9:105371376-105371398 CATTGTTTACATATTGTCTATGG - Intronic
1058627018 9:106944938-106944960 GTTTGTTTACATATTGTCTATGG - Intronic
1058802094 9:108554324-108554346 ATTCATTTACATATTATCTGTGG + Intergenic
1058803606 9:108568347-108568369 ATTTGTTTACATACTGTCTTTGG + Intergenic
1058817067 9:108694310-108694332 ATTCCTTTACATATTGCCTGTGG - Intergenic
1058970504 9:110078118-110078140 ATTCATTTACATATTGTCTAAGG - Intronic
1059064927 9:111073324-111073346 ACTTATTTATATATTGTCTGTGG + Intergenic
1059079007 9:111226925-111226947 ATTTGGTTACATAATATTTGGGG - Intergenic
1059577206 9:115503331-115503353 ATTTGTTTAAAGAGTCTCTGAGG + Intergenic
1059662227 9:116413250-116413272 ATTTATTTATATACTATCTATGG + Intergenic
1059765830 9:117383054-117383076 ATTTGTTTACGTATTGTCTGCGG - Intronic
1059777626 9:117491717-117491739 ATTTGTTTATGTATTGTTTGTGG + Intergenic
1059783904 9:117559706-117559728 ATTTGGTTATATATTGTCTATGG - Intergenic
1059789976 9:117631181-117631203 ATTTGTTTACTTATTTTCTGTGG + Intergenic
1059807626 9:117820725-117820747 ATTTGTTTACATCTTGTCTATGG + Intergenic
1059885871 9:118743978-118744000 ATTTGTTCACATATTGTCGGTGG - Intergenic
1059891250 9:118807730-118807752 ATATATATACATACTTTCTGGGG + Intergenic
1060130290 9:121090699-121090721 ATTTGTTTACATATTGTCTGTGG + Intronic
1060370159 9:123061462-123061484 GTTTATTTACATATTGTCTATGG + Intronic
1061530102 9:131204499-131204521 ATTCGTTTACATATTGTCTACGG - Intronic
1185856563 X:3541768-3541790 ATTCATTTACATATTTTCTGTGG + Intergenic
1185863716 X:3603890-3603912 ACTTGTTTACGTATTGTCTATGG + Intergenic
1186001463 X:5016649-5016671 TTTTATTTACATAATGCCTGTGG - Intergenic
1186129504 X:6451499-6451521 ATTTGTTTAGATAATGTCTATGG - Intergenic
1186138122 X:6541354-6541376 ATTAATTTACATATTGTCTGTGG + Intergenic
1186160450 X:6771835-6771857 ATTCATTTACAGATTGTCTGTGG - Intergenic
1186316035 X:8371807-8371829 ATTTGTTTATGTACTGTCTATGG - Intergenic
1186335007 X:8577006-8577028 ATTTGTTTACATATTGTCTGTGG - Intronic
1186338703 X:8620224-8620246 GTTTGTTTACATATTGTCCATGG - Intronic
1186409239 X:9331689-9331711 ATGTGTTTATATATTGTCTATGG + Intergenic
1186445985 X:9629293-9629315 ATTTGTTTACAGATTGCCAGTGG + Intronic
1186464859 X:9777048-9777070 ATTCCTTTACCTCCTGTCTGTGG - Intronic
1186575686 X:10763102-10763124 ATTTCTATACATATTGTCTATGG - Intronic
1186592554 X:10946609-10946631 ATTTGTTTATATACTGTCTAAGG - Intergenic
1186606488 X:11098117-11098139 ATTCATTTACACATTGTCTGTGG + Intergenic
1186616269 X:11191373-11191395 ATTCATTTACTTACTGTCTGTGG - Intronic
1186636774 X:11414259-11414281 ATTTATTGACATATTGTCTTTGG - Intronic
1186651047 X:11560255-11560277 ATTTGTTTACACATTACCTGTGG - Intronic
1186657593 X:11631768-11631790 TTTTATTTACATATTGTCTGTGG - Intronic
1186666785 X:11724942-11724964 ATTTGTGTACATATTGTCTGTGG - Intergenic
1186671184 X:11769035-11769057 TTTTATTTACATACTATCTGTGG - Intronic
1186684469 X:11911133-11911155 ATTTGTTCACATATTGTCCATGG - Intergenic
1186696912 X:12045152-12045174 ATTCATTTACATATTGTCCGTGG + Intergenic
1186714784 X:12240133-12240155 ATTTGTGTACTTATTGTCTATGG + Intronic
1186722939 X:12325556-12325578 ATTTGTTTCCATATTGTCCTTGG - Intronic
1186730539 X:12404895-12404917 ATTTGTTTATATATAATCTGTGG - Intronic
1186767187 X:12782674-12782696 ATTCATTTACATATTATCTGTGG - Intergenic
1186804234 X:13123708-13123730 AATTGTTTACATATTGTCTGTGG - Intergenic
1186828511 X:13365858-13365880 ATTTGGTTACATACTGCCTATGG + Intergenic
1186833399 X:13413491-13413513 ATTTGTTTACATATTTTCTATGG - Intergenic
1186844472 X:13517093-13517115 ATTCATTTACATATTGTCTATGG + Intergenic
1186857347 X:13639015-13639037 ATTCGTTTACATATTGCCTACGG - Intergenic
1186875399 X:13811586-13811608 ATTTGTTTACATACTATCTAGGG + Intronic
1186902770 X:14075744-14075766 ATTTGTTTACATAGTGTCTAGGG + Intergenic
1186904234 X:14094402-14094424 ATTTGTTTACATATTGTCTATGG + Intergenic
1186922793 X:14301077-14301099 ATTTGTTTAGGTATTGTCTATGG - Intergenic
1186951659 X:14633028-14633050 ATTTGTTTTCATGTTGTCTATGG - Intronic
1186955765 X:14680071-14680093 ATTCATTTACATATTGTCTGTGG - Intronic
1186961413 X:14740629-14740651 ACTTGTTTATTTAATGTCTGTGG - Intergenic
1186995345 X:15115490-15115512 ATTTGTTTACATTTTGTCTGTGG - Intergenic
1187000863 X:15176061-15176083 ATTTATTTATATATTGTCTATGG - Intergenic
1187006305 X:15236297-15236319 ATTAATTTACATATTGTCTATGG - Intronic
1187149724 X:16670344-16670366 ATTTGTTTACATATTGTCTATGG - Intronic
1187297554 X:18016545-18016567 ATTTGTTTATGTATTGCCTGTGG - Intergenic
1187539125 X:20174059-20174081 ACTTGTTTATGTATTGTCTGTGG + Intronic
1187563101 X:20420774-20420796 ATTTGTTTTCATACTGTCTATGG - Intergenic
1187709016 X:22035452-22035474 ATTTGTGTACATATTGTCTATGG - Intronic
1187759676 X:22567343-22567365 ATTTATTTACATATTATCTCTGG + Intergenic
1187767848 X:22662860-22662882 ATTTGTTTACATATTGTCTATGG + Intergenic
1187782967 X:22849768-22849790 ATTTGTTTAAATACAGTGTTCGG + Intergenic
1187800629 X:23058718-23058740 ATTAGTTTACATGTTGTCTTTGG - Intergenic
1187811749 X:23186591-23186613 AGTTGTTTACATATTGCCTATGG - Intergenic
1187937647 X:24351689-24351711 ATTCATTTACATACTGTTTATGG - Intergenic
1188100910 X:26083107-26083129 CATTGTTTACGTACTGTCTATGG - Intergenic
1188177901 X:27016776-27016798 ATTATTTCACATATTGTCTGTGG + Intergenic
1188313995 X:28651345-28651367 ATTTGTTTACATATTGTTAATGG + Intronic
1188337056 X:28949455-28949477 ATTGGTTAATATACTGTCTGTGG + Intronic
1188398630 X:29717668-29717690 ATTTGTTTACATATTGTCTATGG + Intronic
1188421862 X:29999881-29999903 ATTTGTTTACCTGTTGTCTATGG - Intergenic
1188467536 X:30499061-30499083 ATTCGTTTACATGTTGTCTGTGG - Intergenic
1188474174 X:30572827-30572849 ATTTGTTTACATATTGTCTATGG - Intronic
1188502672 X:30845536-30845558 ATTTGTTTACATATTGCCTATGG - Intronic
1188599421 X:31943086-31943108 ATTCATTTACATATTGTCTATGG + Intronic
1188623476 X:32255405-32255427 ATTCATTTACATATTGTCTATGG + Intronic
1188631505 X:32367978-32368000 ATTTGTATACATGCTGTTTTGGG + Intronic
1188809977 X:34641814-34641836 GCTTGTTTACACATTGTCTGTGG - Intronic
1188919633 X:35956881-35956903 ATTTGTTCACCTATTGTCTAAGG + Intronic
1189148048 X:38675179-38675201 ATGTGTTCACATACTGTCTGTGG - Intronic
1189206626 X:39245335-39245357 ATTTGTTTAAATATTGTCTGTGG - Intergenic
1189244543 X:39553353-39553375 ATTTGTTTACATATTGAATAGGG + Intergenic
1189401323 X:40671479-40671501 ACTTGTTTATATAATGTCTATGG - Intronic
1189498610 X:41532287-41532309 TTTTGTTTACATATTGCCTATGG + Intronic
1189752986 X:44241692-44241714 AATCATTTACATTCTGTCTGTGG + Intronic
1189778287 X:44489677-44489699 ATTTGTTTACATATTGTCCATGG - Intergenic
1189967059 X:46385729-46385751 ATTTGTGAAAATACTGTCAGAGG - Intergenic
1189991465 X:46599220-46599242 ATTCATTTGCTTACTGTCTGTGG - Intergenic
1190031017 X:46972933-46972955 ATTTGTTTATGTACTGTCTATGG + Intronic
1190132428 X:47761532-47761554 ATTATTTTACATAGTTTCTGTGG + Intergenic
1190135788 X:47796445-47796467 ATTTGTTTACACACAGTCTATGG + Intergenic
1190846908 X:54201693-54201715 ATTTGGTTACATATTCTCTATGG + Intronic
1191021211 X:55862388-55862410 ATTTGGTTACTTACTGAATGTGG + Intergenic
1191998119 X:67118570-67118592 GTTTGTTTACATATTGTCTATGG - Intergenic
1192035351 X:67557101-67557123 GTTTGTTTACTTACTGTATGTGG + Intronic
1192085719 X:68095344-68095366 ATCTGTTTCCATATTGTCTATGG + Intronic
1192385712 X:70667188-70667210 ATTTGATTACATACTGTCTATGG + Intronic
1192489898 X:71567008-71567030 ACTTGTTTACACATTGTCTGTGG + Intronic
1192593349 X:72380566-72380588 ATTCATTTACATACTGTCTATGG + Intronic
1192778974 X:74274972-74274994 ATTTGTATCCATATTGTCTATGG + Intergenic
1192886314 X:75338062-75338084 ATTTGTCTACATAGTCTGTGAGG - Intergenic
1193221629 X:78933525-78933547 ATATGTTTAGATACTGTCTATGG + Intergenic
1193429238 X:81380175-81380197 ATTTCTTTACATATTGTCTATGG + Intergenic
1193801448 X:85941663-85941685 ATTTGTTAACATATTGTCTATGG + Intronic
1194127329 X:90035842-90035864 GTTTGTTTATATATTGTCTATGG + Intergenic
1194296837 X:92136573-92136595 ATTCTTTTTCATACTGCCTGTGG + Intronic
1194696913 X:97063917-97063939 ATTTGTTTACTTAGTGTTTCTGG + Intronic
1194757695 X:97757078-97757100 ATTTTAATAAATACTGTCTGTGG - Intergenic
1194821879 X:98518661-98518683 ATTTGCTTATATATTGTCTAAGG + Intergenic
1195382815 X:104286797-104286819 ATTCATTTACCTATTGTCTGTGG + Intergenic
1195464304 X:105163124-105163146 AATTTGTTACATACTGTCTATGG + Intronic
1195518453 X:105803894-105803916 ATTTGTTTACATATTGTCTCTGG + Intergenic
1195683125 X:107563544-107563566 ATTTGTTTATGCATTGTCTGTGG - Intronic
1195731409 X:107971756-107971778 ATTTGTTTACATATTATCTATGG + Intergenic
1195761000 X:108246483-108246505 ATTTGTTTACTTATTGCCTCTGG - Intronic
1196048541 X:111281301-111281323 TTTGGTTTTCTTACTGTCTGGGG - Intergenic
1196203384 X:112911443-112911465 ATTTGTTTACATATTGTTTGTGG + Intergenic
1196230589 X:113216714-113216736 ATTTGTTTATGTATTGTCTATGG - Intergenic
1196316844 X:114236903-114236925 ATTTGTTTATGTATTGTCTATGG - Intergenic
1196325817 X:114400999-114401021 ATTTATTTATATATTGTCTAGGG + Intergenic
1196713542 X:118788487-118788509 ATTCATTTATATATTGTCTGTGG + Intronic
1196778943 X:119365133-119365155 ATTCATTTACATATTGTCTATGG + Intergenic
1197032881 X:121839422-121839444 ATTTGTTTACATATTGTCTATGG + Intergenic
1197300777 X:124777929-124777951 ATTCATTTACACATTGTCTGTGG - Intronic
1197687588 X:129458137-129458159 ATTTGTTTATGTATTGTCTTTGG - Intronic
1198173423 X:134130350-134130372 ATATATTTACATACTCTCTGTGG - Intergenic
1198220668 X:134598739-134598761 ACTTGTTAACAGACTGTTTGTGG + Intronic
1198387406 X:136142780-136142802 ATTTGTTTACATATTATCTGTGG - Intergenic
1198419348 X:136453969-136453991 ATTTGTTTATACATTGTCTGTGG - Intergenic
1198457067 X:136827304-136827326 ATTTGTTTACATACTGTCTTTGG + Intergenic
1198924117 X:141768697-141768719 ATTCTTTTACATATTGTCTATGG - Intergenic
1199202298 X:145106780-145106802 ACTGATTTACATATTGTCTGTGG + Intergenic
1199335629 X:146616165-146616187 ATTAGTTTACATATTGCCTATGG + Intergenic
1199429433 X:147742275-147742297 ATTTATTTACACGTTGTCTGCGG + Intergenic
1199536558 X:148908870-148908892 ATTCATTTCCATATTGTCTGTGG + Intronic
1200614351 Y:5361150-5361172 ATTCTTTTTCATACTGCCTGTGG + Intronic
1200749336 Y:6930454-6930476 ATTTGTTTTCATAGTTTCTCTGG - Intronic
1200769531 Y:7110736-7110758 ATTTCTTTATGTACTGCCTGTGG - Intergenic
1200807609 Y:7448345-7448367 ATTCATTTACATATTTTCTGTGG - Intergenic
1200855786 Y:7936819-7936841 ATATGTTAAAATACCGTCTGTGG + Intergenic
1200949205 Y:8877550-8877572 ATTCTTTTACATATTGTCTATGG - Intergenic
1201428498 Y:13881257-13881279 ATTTGTTTACATATTGTCTGTGG + Intergenic
1201682596 Y:16665315-16665337 ATTGGTTTACCTATTGTCTCTGG - Intergenic
1201747243 Y:17390858-17390880 ATTTTTTTACATACACTCTGTGG - Intergenic
1202047162 Y:20746827-20746849 ATTTCTTTATGTACTGCCTGTGG - Intergenic
1202261422 Y:22974210-22974232 ATATGTCAACATACTTTCTGTGG - Intronic
1202300154 Y:23404840-23404862 ATTTAGTTACATATTGTCTATGG - Intergenic
1202414410 Y:24607951-24607973 ATATGTCAACATACTTTCTGTGG - Intronic
1202456375 Y:25062135-25062157 ATATGTCAACATACTTTCTGTGG + Intronic
1202570656 Y:26265758-26265780 ATTTAGTTACATATTGTCTATGG + Intergenic