ID: 904414148

View in Genome Browser
Species Human (GRCh38)
Location 1:30345642-30345664
Sequence CTTTGGCTGTGTTCCAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904414146_904414148 3 Left 904414146 1:30345616-30345638 CCACAGACAGTATGTAAACAAAT 0: 3
1: 47
2: 171
3: 442
4: 1047
Right 904414148 1:30345642-30345664 CTTTGGCTGTGTTCCAATAAAGG No data
904414145_904414148 23 Left 904414145 1:30345596-30345618 CCATTGTAGCATGGAAGTGGCCA No data
Right 904414148 1:30345642-30345664 CTTTGGCTGTGTTCCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904414148 Original CRISPR CTTTGGCTGTGTTCCAATAA AGG Intergenic
No off target data available for this crispr