ID: 904417397

View in Genome Browser
Species Human (GRCh38)
Location 1:30371742-30371764
Sequence TGGCCTGGCCATCGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904417397_904417406 28 Left 904417397 1:30371742-30371764 CCTGGCACACGATGGCCAGGCCA No data
Right 904417406 1:30371793-30371815 TTCCTGACCCACATTGAAAGTGG No data
904417397_904417400 -10 Left 904417397 1:30371742-30371764 CCTGGCACACGATGGCCAGGCCA No data
Right 904417400 1:30371755-30371777 GGCCAGGCCAGCCCTGGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904417397 Original CRISPR TGGCCTGGCCATCGTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr