ID: 904418858

View in Genome Browser
Species Human (GRCh38)
Location 1:30378750-30378772
Sequence ACTGAGGTGCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904418851_904418858 -2 Left 904418851 1:30378729-30378751 CCCCATTTTACAGATGAGGAAAC 0: 447
1: 2399
2: 5818
3: 10422
4: 14829
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418843_904418858 27 Left 904418843 1:30378700-30378722 CCCCCCTATGGGGTGGATGCCAC No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418849_904418858 8 Left 904418849 1:30378719-30378741 CCACGCTTGGCCCCATTTTACAG No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418845_904418858 25 Left 904418845 1:30378702-30378724 CCCCTATGGGGTGGATGCCACGC No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418852_904418858 -3 Left 904418852 1:30378730-30378752 CCCATTTTACAGATGAGGAAACT 0: 580
1: 3018
2: 7778
3: 13577
4: 18950
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418846_904418858 24 Left 904418846 1:30378703-30378725 CCCTATGGGGTGGATGCCACGCT No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418847_904418858 23 Left 904418847 1:30378704-30378726 CCTATGGGGTGGATGCCACGCTT No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418853_904418858 -4 Left 904418853 1:30378731-30378753 CCATTTTACAGATGAGGAAACTG 0: 714
1: 3520
2: 8648
3: 15140
4: 20726
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data
904418844_904418858 26 Left 904418844 1:30378701-30378723 CCCCCTATGGGGTGGATGCCACG No data
Right 904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904418858 Original CRISPR ACTGAGGTGCAGAGGGAGAA GGG Intergenic
No off target data available for this crispr