ID: 904419099

View in Genome Browser
Species Human (GRCh38)
Location 1:30379961-30379983
Sequence CAACTCCCAGCAACCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904419099_904419104 18 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419104 1:30380002-30380024 TGCTGACCACTGTGCACAGCAGG No data
904419099_904419106 24 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419106 1:30380008-30380030 CCACTGTGCACAGCAGGAGCTGG No data
904419099_904419101 -9 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419101 1:30379975-30379997 TGGGAGTTGCTGCTGGCCACTGG No data
904419099_904419102 -8 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419102 1:30379976-30379998 GGGAGTTGCTGCTGGCCACTGGG No data
904419099_904419107 25 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904419099 Original CRISPR CAACTCCCAGCAACCCCCTC AGG (reversed) Intergenic
No off target data available for this crispr