ID: 904419103

View in Genome Browser
Species Human (GRCh38)
Location 1:30379991-30380013
Sequence CAGTGGTCAGCAACTCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904419103_904419110 5 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419110 1:30380019-30380041 AGCAGGAGCTGGGCACTGGAGGG No data
904419103_904419112 22 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419112 1:30380036-30380058 GGAGGGGCTGCCTACACTGCAGG No data
904419103_904419111 6 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419111 1:30380020-30380042 GCAGGAGCTGGGCACTGGAGGGG No data
904419103_904419107 -5 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG No data
904419103_904419113 29 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419113 1:30380043-30380065 CTGCCTACACTGCAGGAGCTAGG No data
904419103_904419108 1 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419108 1:30380015-30380037 GCACAGCAGGAGCTGGGCACTGG No data
904419103_904419109 4 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419109 1:30380018-30380040 CAGCAGGAGCTGGGCACTGGAGG No data
904419103_904419106 -6 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419106 1:30380008-30380030 CCACTGTGCACAGCAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904419103 Original CRISPR CAGTGGTCAGCAACTCCCAG TGG (reversed) Intergenic
No off target data available for this crispr