ID: 904419107

View in Genome Browser
Species Human (GRCh38)
Location 1:30380009-30380031
Sequence CACTGTGCACAGCAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904419103_904419107 -5 Left 904419103 1:30379991-30380013 CCACTGGGAGTTGCTGACCACTG No data
Right 904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG No data
904419099_904419107 25 Left 904419099 1:30379961-30379983 CCTGAGGGGGTTGCTGGGAGTTG No data
Right 904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG No data
904419098_904419107 28 Left 904419098 1:30379958-30379980 CCACCTGAGGGGGTTGCTGGGAG No data
Right 904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904419107 Original CRISPR CACTGTGCACAGCAGGAGCT GGG Intergenic
No off target data available for this crispr