ID: 904423541

View in Genome Browser
Species Human (GRCh38)
Location 1:30409254-30409276
Sequence TCCATAAAGTCCAAATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904423541_904423544 9 Left 904423541 1:30409254-30409276 CCAGGAAATTTGGACTTTATGGA No data
Right 904423544 1:30409286-30409308 GTCTGCTTTGATGGAACTGAAGG No data
904423541_904423543 0 Left 904423541 1:30409254-30409276 CCAGGAAATTTGGACTTTATGGA No data
Right 904423543 1:30409277-30409299 AAGCTGGCAGTCTGCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904423541 Original CRISPR TCCATAAAGTCCAAATTTCC TGG (reversed) Intergenic
No off target data available for this crispr