ID: 904424930

View in Genome Browser
Species Human (GRCh38)
Location 1:30417101-30417123
Sequence CCGGGCACCCCCGCGTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904424925_904424930 -3 Left 904424925 1:30417081-30417103 CCTCACAGGCTACTTCAGGGCCG No data
Right 904424930 1:30417101-30417123 CCGGGCACCCCCGCGTAGTTGGG No data
904424920_904424930 2 Left 904424920 1:30417076-30417098 CCACCCCTCACAGGCTACTTCAG No data
Right 904424930 1:30417101-30417123 CCGGGCACCCCCGCGTAGTTGGG No data
904424924_904424930 -2 Left 904424924 1:30417080-30417102 CCCTCACAGGCTACTTCAGGGCC No data
Right 904424930 1:30417101-30417123 CCGGGCACCCCCGCGTAGTTGGG No data
904424923_904424930 -1 Left 904424923 1:30417079-30417101 CCCCTCACAGGCTACTTCAGGGC No data
Right 904424930 1:30417101-30417123 CCGGGCACCCCCGCGTAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904424930 Original CRISPR CCGGGCACCCCCGCGTAGTT GGG Intergenic
No off target data available for this crispr