ID: 904424995

View in Genome Browser
Species Human (GRCh38)
Location 1:30417374-30417396
Sequence GTGGGTCAACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904424987_904424995 15 Left 904424987 1:30417336-30417358 CCAGAGTGGGCTCAGGAGTAGGG No data
Right 904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG No data
904424985_904424995 20 Left 904424985 1:30417331-30417353 CCTGGCCAGAGTGGGCTCAGGAG No data
Right 904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904424995 Original CRISPR GTGGGTCAACAGAATGAGGA AGG Intergenic
No off target data available for this crispr