ID: 904425044

View in Genome Browser
Species Human (GRCh38)
Location 1:30417577-30417599
Sequence CTTTGAGTAAGACCGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425044_904425047 -4 Left 904425044 1:30417577-30417599 CCAGCTTCCGGTCTTACTCAAAG No data
Right 904425047 1:30417596-30417618 AAAGGAAAATCCAAATCTGCTGG No data
904425044_904425048 1 Left 904425044 1:30417577-30417599 CCAGCTTCCGGTCTTACTCAAAG No data
Right 904425048 1:30417601-30417623 AAAATCCAAATCTGCTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425044 Original CRISPR CTTTGAGTAAGACCGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr