ID: 904425044 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:30417577-30417599 |
| Sequence | CTTTGAGTAAGACCGGAAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904425044_904425047 | -4 | Left | 904425044 | 1:30417577-30417599 | CCAGCTTCCGGTCTTACTCAAAG | No data | ||
| Right | 904425047 | 1:30417596-30417618 | AAAGGAAAATCCAAATCTGCTGG | No data | ||||
| 904425044_904425048 | 1 | Left | 904425044 | 1:30417577-30417599 | CCAGCTTCCGGTCTTACTCAAAG | No data | ||
| Right | 904425048 | 1:30417601-30417623 | AAAATCCAAATCTGCTGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904425044 | Original CRISPR | CTTTGAGTAAGACCGGAAGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||