ID: 904425392

View in Genome Browser
Species Human (GRCh38)
Location 1:30419468-30419490
Sequence CGGGACTGTCCCAGGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425392_904425398 -2 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425392_904425401 19 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425401 1:30419510-30419532 GGAGCTGTTGACCAATCCATGGG No data
904425392_904425402 20 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425392_904425400 18 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425400 1:30419509-30419531 TGGAGCTGTTGACCAATCCATGG No data
904425392_904425403 21 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425392 Original CRISPR CGGGACTGTCCCAGGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr