ID: 904425398

View in Genome Browser
Species Human (GRCh38)
Location 1:30419489-30419511
Sequence CGCCACAGAGCAGGTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425389_904425398 10 Left 904425389 1:30419456-30419478 CCATTCATGTGGCCTCCAAACCT No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425394_904425398 -10 Left 904425394 1:30419476-30419498 CCTGGGACAGTCCCGCCACAGAG No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425392_904425398 -2 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425387_904425398 15 Left 904425387 1:30419451-30419473 CCAACCCATTCATGTGGCCTCCA No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425393_904425398 -5 Left 904425393 1:30419471-30419493 CCAAACCTGGGACAGTCCCGCCA No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data
904425388_904425398 11 Left 904425388 1:30419455-30419477 CCCATTCATGTGGCCTCCAAACC No data
Right 904425398 1:30419489-30419511 CGCCACAGAGCAGGTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425398 Original CRISPR CGCCACAGAGCAGGTGTGAA TGG Intergenic
No off target data available for this crispr