ID: 904425402

View in Genome Browser
Species Human (GRCh38)
Location 1:30419511-30419533
Sequence GAGCTGTTGACCAATCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425397_904425402 0 Left 904425397 1:30419488-30419510 CCGCCACAGAGCAGGTGTGAATG No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425396_904425402 1 Left 904425396 1:30419487-30419509 CCCGCCACAGAGCAGGTGTGAAT No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425392_904425402 20 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425399_904425402 -3 Left 904425399 1:30419491-30419513 CCACAGAGCAGGTGTGAATGGAG No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425394_904425402 12 Left 904425394 1:30419476-30419498 CCTGGGACAGTCCCGCCACAGAG No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data
904425393_904425402 17 Left 904425393 1:30419471-30419493 CCAAACCTGGGACAGTCCCGCCA No data
Right 904425402 1:30419511-30419533 GAGCTGTTGACCAATCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425402 Original CRISPR GAGCTGTTGACCAATCCATG GGG Intergenic
No off target data available for this crispr