ID: 904425403

View in Genome Browser
Species Human (GRCh38)
Location 1:30419512-30419534
Sequence AGCTGTTGACCAATCCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425392_904425403 21 Left 904425392 1:30419468-30419490 CCTCCAAACCTGGGACAGTCCCG No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data
904425396_904425403 2 Left 904425396 1:30419487-30419509 CCCGCCACAGAGCAGGTGTGAAT No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data
904425399_904425403 -2 Left 904425399 1:30419491-30419513 CCACAGAGCAGGTGTGAATGGAG No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data
904425393_904425403 18 Left 904425393 1:30419471-30419493 CCAAACCTGGGACAGTCCCGCCA No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data
904425397_904425403 1 Left 904425397 1:30419488-30419510 CCGCCACAGAGCAGGTGTGAATG No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data
904425394_904425403 13 Left 904425394 1:30419476-30419498 CCTGGGACAGTCCCGCCACAGAG No data
Right 904425403 1:30419512-30419534 AGCTGTTGACCAATCCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425403 Original CRISPR AGCTGTTGACCAATCCATGG GGG Intergenic
No off target data available for this crispr