ID: 904425442

View in Genome Browser
Species Human (GRCh38)
Location 1:30419785-30419807
Sequence AGAGTAAAGCGTTAAGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425442_904425444 -3 Left 904425442 1:30419785-30419807 CCAAAAGCTTAACGCTTTACTCT No data
Right 904425444 1:30419805-30419827 TCTCCAGCTGCAGCAGACCTGGG No data
904425442_904425443 -4 Left 904425442 1:30419785-30419807 CCAAAAGCTTAACGCTTTACTCT No data
Right 904425443 1:30419804-30419826 CTCTCCAGCTGCAGCAGACCTGG No data
904425442_904425446 11 Left 904425442 1:30419785-30419807 CCAAAAGCTTAACGCTTTACTCT No data
Right 904425446 1:30419819-30419841 AGACCTGGGCAGCCAACGTCAGG No data
904425442_904425447 12 Left 904425442 1:30419785-30419807 CCAAAAGCTTAACGCTTTACTCT No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425442 Original CRISPR AGAGTAAAGCGTTAAGCTTT TGG (reversed) Intergenic
No off target data available for this crispr