ID: 904425447

View in Genome Browser
Species Human (GRCh38)
Location 1:30419820-30419842
Sequence GACCTGGGCAGCCAACGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904425442_904425447 12 Left 904425442 1:30419785-30419807 CCAAAAGCTTAACGCTTTACTCT No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data
904425439_904425447 15 Left 904425439 1:30419782-30419804 CCCCCAAAAGCTTAACGCTTTAC No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data
904425438_904425447 16 Left 904425438 1:30419781-30419803 CCCCCCAAAAGCTTAACGCTTTA No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data
904425440_904425447 14 Left 904425440 1:30419783-30419805 CCCCAAAAGCTTAACGCTTTACT No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data
904425441_904425447 13 Left 904425441 1:30419784-30419806 CCCAAAAGCTTAACGCTTTACTC No data
Right 904425447 1:30419820-30419842 GACCTGGGCAGCCAACGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904425447 Original CRISPR GACCTGGGCAGCCAACGTCA GGG Intergenic
No off target data available for this crispr