ID: 904426565

View in Genome Browser
Species Human (GRCh38)
Location 1:30427628-30427650
Sequence GTTCAGCAGCACCACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904426563_904426565 5 Left 904426563 1:30427600-30427622 CCAAAGGAAAAGTCAAATCATAG No data
Right 904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904426565 Original CRISPR GTTCAGCAGCACCACATTGT AGG Intergenic